Immunogenetics (2006) 58: 407–421DOI 10.1007/s00251-006-0119-0

ORIGINAL PAPER

Janet E. Fulton . Helle R. Juul-Madsen .Christopher M. Ashwell . Amy M. McCarron .James A. Arthur . Neil P. O’Sullivan .Robert L. Taylor Jr

Molecular genotype identification of the Gallus gallus majorhistocompatibility complex

Received: 22 December 2005 / Accepted: 5 April 2006 / Published online: 5 May 2006# Springer-Verlag 2006

Abstract The chicken major histocompatibility complex(MHC) is commonly defined by serologic reactions oferythrocytes with antibodies specific to the highly poly-morphic MHC class I (BF) and MHC class IV (BG)antigens. The microsatellite marker LEI0258 is known tobe physically located within the MHC, between the BG andBF regions. DNA from various serologically defined MHChaplotypes was amplified by polymerase chain reactionwith primers surrounding this marker. Twenty-six dis-tinctive allele sizes were identified. Some serologicallywell-defined MHC haplotypes shared a common LEI0258allele size but could be distinguished either by the additionof information from another nearby marker (MCW0371) orby small indels or single nucleotide polymorphism (SNP)differences between the alleles. The association betweenLEI0258 allele and serologically defined MHC haplotype

was very consistent for the same haplotype from multiplesources. Sequence information for the region defined byLEI0258 was obtained for 51 different haplotypes. Twointernal repeats whose lengths were 13 and 12 bp,respectively, are the primary basis for allelic variability.Allele size variation ranges from 182 to 552 bp. Four indelsand five SNPs in the surrounding sequence provideadditional means for distinguishing alleles. Typing withLEI0258 and MCW0371 will be useful in identifyingMHC haplotypes in outbred populations of chickensparticularly for the initial development of serologicalreagents.

Keywords Chicken MHC . Molecular identification .MHC haplotype . Microsatellite . Genotype sequence

Introduction

The chicken major histocompatibility complex (MHC) isknown to have a very strong association to diseaseresistance and susceptibility to numerous pathogensincluding Marek’s disease virus (Hansen et al. 1967; Brileset al. 1977; Bacon et al. 2001), Rous sarcoma tumor virus(Bacon et al. 1981; Taylor 2004), avian leukosis virus (Yooand Sheldon 1992), fowl cholera (Lamont et al. 1987),coccidiosis (Lillehoj et al. 1989), and salmonella (Cotter etal. 1998). The association between MHC and diseaseoutcome is found in laboratory strains of chickens andcommercially important flocks (Hansen et al. 1967; Baconet al. 1981). Thus, there is considerable interest in accurateidentification of MHC types in chickens.

The chicken MHC is commonly identified with poly-clonal antisera produced by immunizations between birdshaving different haplotypes (Briles and Briles 1982; Juul-Madsen et al. 2006). The MHC serological reactivity is dueto both BG antigens and BF-encoded class I molecules. BGand BF genes are in linkage disequilibrium with each otherand with BL (MHC class II genes). The MHC haplotypenomenclature was standardized initially using serologicreagents (Briles et al. 1982). A recent nomenclature update

Dedication: This manuscript is dedicated to W. Elwood and RuthW. Briles in recognition of more than five decades of researchdedicated to the discovery and understanding of avian bloodgroups. Dr. and Mrs. Briles continue to conduct exceptionalresearch, share their expertise, and inspire scientists toinvestigate the intricacies of avian immunogenetics.

J. E. Fulton (*) . A. M. McCarron .J. A. Arthur . N. P. O’SullivanHy-Line International,P.O. Box 310 Dallas Center, IA 50063, USAe-mail: jfulton@hyline.comTel.: +1-515-9924173Fax: +1-515-9923203

H. R. Juul-MadsenDepartment of Animal Health, Welfare and Nutrition,Danish Institute of Agricultural Sciences,8830 Tjele, Denmark

C. M. AshwellDepartment of Poultry Science,North Carolina State University,Raleigh, NC 27695, USA

R. L. Taylor JrUniversity of New Hampshire,Kendall Hall,Durham, NH 03824, USA

ties standard haplotypes with gene sequences and experi-mental flocks (Miller et al. 2004). These haplotypes areidentified in inbred lines, with the majority being derivedfrom the White Leghorn (WL) breed. Serological typing isfraught with cross-reactivity (Fulton et al. 1995) that cancomplicate application of the technique to outbredpopulations (Kroemer et al. 1990). The presence of cross-reactive MHC epitopes, additional polymorphic non-MHCantigens, and the existence of novel haplotypes in thesecontribute to this problem. Inbred lines contain a limitedcombination of BG, BF, and BL genes. In outbredpopulations, novel alleles and combinations of alleles arelikely to exist. This additional level of variation results inproduction difficulties for haplotype-specific antiserawhich can yield inaccurate haplotype identification.

With the advent of molecular biology tools, Bhaplotypes can now be determined with several methodsincluding two-dimensional (2-D) gels (Miller et al. 1984),restriction fragment length polymorphism (RFLP) (Milleret al. 1988; Juul-Madsen et al. 1993; Emara et al. 2002;Landesman et al. 1993; Iglesias et al. 2003), DNAsequence (Sung et al. 1993; Miller et al. 2004), single-strand conformation polymorphism (Goto et al. 2002), andsequence-specific polymerase chain reaction (SS-PCR)(Zheng et al. 1999; Livant and Ewald 2005). These toolshave also been applied to study MHC diversity in broiler-type chickens (Li et al. 1997, 1999; Livant et al. 2001;Livant and Ewald 2005). These methods identify eitherprotein (2-D gels) or DNA differences within very definedregions (RFLP, amplified fragment length polymorphism,and SS-PCR) producing very consistent and repeatableresults among labs. Unfortunately, these techniques are notalways practical for large numbers of samples.

The microsatellite marker LEI0258 (McConnell et al.1999) maps to chromosome 16. This marker is also foundin a clone that encompasses a large portion of the chickenMHC (GenBank AL023516; Guillemot et al. 1988). Anadditional marker, MCW0371, reported by Buitenhuis etal. (2003), is located 10,560 bp downstream of LEI0258 inthe same clone. Due to their close physical location togenes of the MHC, these markers were investigated asgenetic indicators for MHC haplotype. Samples wereobtained from numerous MHC-defined chicken lines andallele sizes were determined for these two markers. TheLEI0258 marker is particularly intriguing because of thelarge number of alleles that were identified and the largerange in allele size. These large allelic differences are easilydistinguishable using relatively inexpensive electrophoret-ic size separation methods and prompted the investigationof this marker as an indicator of MHC haploptype. Theunderlying cause of this variability was investigated bysequence analysis.

Materials and methods

Genetic material

Blood samples or purified DNA were obtained from birdswhose MHC haplotype had been identified by serology.

The lines and haplotypes sampled are summarized inTable 1. These lines represent both laboratory andcommercial sources of MHC haplotypes. The originalbreed source of the MHC haplotype is given, as is theoriginal line that provided the haplotype (if known). Mostof these lines have been genetically isolated for more than20 years and, in many cases, trace back through more than40 years of genetic isolation. The University of California-Davis samples are from a group of inbred lines that wasdeveloped more than 30 years ago and has since beenmaintained as MHC homozygotes (Pisenti et al. 2001). Thesamples from Northern Illinois University are from acollection of MHC haplotypes acquired over many yearsby Dr. Elwood Briles, maintained in fully pedigreedfamilies and used for reagent development and asreferences for MHC typing. The University of NewHampshire haplotypes are all derived from the NewHampshire (NH) breed. They are maintained within anMHC segregating population and are serologically geno-typed (Collins et al. 1979; Taylor 2004). The samples fromthe Danish Institute of Agricultural Science, Tjele are acollection of MHC haplotypes that have been acquired andmaintained for up to 20 years (Juul-Madsen et al. 2006).The MHC haplotypes from the Avian Disease and Oncol-ogy Lab (ADOL) are from a series of MHC congenic linesthat were developed in the late 1970s. These haplotypeswere commonly found in commercial WL at that time(Bacon et al. 2000). The samples from Iowa StateUniversity (ISU) were from various partially or fullyinbred lines of defined haplotypes. These lines have beenclosed for more than 40 years and have been maintained byserological typing. Detailed descriptions of the lines can befound in Lamont et al. (1992) and Zhou and Lamont(1999). The commercial sources are from diverse brownand white egg laying lines maintained by Hy-LineInternational. Each of these sources represent uniquecommercial lines that have been maintained as closedbreeding flocks for more than 30 generations. Within thesecommercial lines, where a haplotype is listed more thanonce, this haplotype was obtained from more than onesource. Haplotypes with the same number designation wereserologically identical.

All haplotypes for which LEI0258 allele sequenceinformation was obtained are indicated in Table 1. Someof the haplotypes are serologically very similar but notidentical to each other. These haplotypes are numberedbased on the similar haplotype, but followed with the 0.1 or0.2 designation. While many of the haplotypes tested havebeen historically identified as being similar by serology,not all have been extensively compared.

Cell lines

The cell lines were derived from MHC-defined chickens.These lines are summarized in Table 1. The test materialDNA was provided as either purified DNA (ADOL, H.Hunt; COH, M. Miller; COR, K. Schat) or it was purifiedfrom 107 previously frozen tissue culture cells (ATCC

408

Table 1 Sources of MHC haplotypes from chicken genetic stocks and cell lines tested for markers LEI0258 and MCW0371

Source Line B haplotype Breed Origin Sequence

UCD UCD331 2 WL Hy-Line dwarf WLUCD254 15 WL UCD-007UCD380 17 WL UCD-003 AUCD253 18 WL UCD-002 AUCD335 19 WL UCD-159 AUCD330 21 AUS UCD-100 AUCD312 24 NH UCD-200 AUCD336 Q RJF UCD-001 AUCD342 C CRJF UCD-500 A

NIU NIU 2 WL DeKalb WLNIU 5 WL CommercialNIU 6.1 WL DeKalb WL AWisc3 8 ANC Wisconsin AWisc3 11 ANC Wisconsin AWisc3 11.1 ANC Wisconsin ANIU 12.3 WL Commercial ANIU 13 WL CommercialNIU 19 WL DeKalb WLNIU 21 WL DeKalb WLNIU 27 WL DeKalb WL ANIU 29 WL Hy-Line A

UNH UNH105 22 NH Hubbard AUNH105 23 NH Hubbard AUNH105 24 NH Hubbard AUNH105 26 NH Hubbard A

DIAS 32 2 WL Scandinavian4 4 WL Prague CC A36 6 WL GB2 A2 12 WL Prague CB133 13.2 WL GB1 A34 14 WL H.B14A, Hy-Line A22 15 WL Cornell K A21 19 WL H-B19, USA WL39 19.1 WL H-B19, USA WL A131 19.1 WL Scandinavian A21 21 WL H-B21, Hy-Line130 B130 WC Scandinavian A131 B131 WC Scandinavian A201 B201 RIR Scandinavian A111 BW1 RJF Copenhagen Zoo A13 BW3 RJF Copenhagen Zoo A14 BW4 RJF Copenhagen Zoo A11 BW11 RJF Copenhagen Zoo A

ADOL 15.6-2 2 WL ADOL 6-2 A15.7-2 2 WL ADOL 7-2 A15.15I-5 5 WL ADOL 15I4 A15.C-12 12 WL Reaseheath C A15.P-13 13 WL Cornell P A15I5 15 WL ADOL 15I5 A15.P-19 19 WL Cornell P A15.N-21 21 WL Cornell N A

ISU GH1 1 WL Ghostly Hatchery AS1-1L 1 WL Hy-LineS1-1H 1.1 WL Hy-Line

409

Source Line B haplotype Breed Origin Sequence

S1-1L 1.2 WL Hy-LineM5.1 5.1 FAY Egypt AGHs6 6 WL GB2 AHN12 12.1 WL H&NHN12 12.2 WL H&N AGH13 13 WL GB1 AGHs13 13 WL GB1HN15 15 WL H&NGH15.1 15.1 WL GH and H&N AM15.2 15.2 FAY Egypt AS1-19H 19 WL Hy-Line AS1-19L 19 WL Hy-Line ASP21.1 21.1 SP Spain A

HYL Commercial 2 WL Hy-Line Commercial ACommercial 2 WL Hy-Line Commercial ACommercial 5 WL Hy-Line Commercial ACommercial 10 WL Hy-Line Commercial ACommercial 12 WL Hy-Line Commercial ACommercial 12 WL Hy-Line CommercialCommercial 13.1 WL Hy-Line Commercial ACommercial 15 WL Hy-Line Commercial ACommercial 15 WL Hy-Line CommercialCommercial 19 WL Hy-Line Commercial ACommercial 19 WL Hy-Line Commercial ACommercial 21 WL Hy-Line Commercial ACommercial 21 WL Hy-Line CommercialCommercial 24 RIR Hy-Line Commercial ACommercial 24 WPR Hy-Line Commercial ACommercial 29 WL Hy-Line CommercialCommercial 61 WL Hy-Line Commercial ACommercial 62 WL Hy-Line Commercial ACommercial 71 WPR Hy-Line Commercial ACommercial 72 WPR Hy-Line Commercial ACommercial 72 WPR Hy-Line CommercialCommercial 73 WPR Hy-Line Commercial ACommercial 73 WPR Hy-Line CommercialCommercial 74 WPR Hy-Line Commercial ACommercial 75 RIR Hy-Line CommercialCommercial 75 WPR Hy-Line Commercial ACommercial 75 WPR Hy-Line Commercial ACommercial 76 WPR Hy-Line CommercialCommercial 77 RIR Hy-Line CommercialCommercial 78 RIR Hy-Line Commercial A

Cell linesADOL RP9 2/15 WL Line 15I5 x 72

RP2 2/15 WL Line 15I5 x 72DF1 21 WL Line 0

ATCC DT40 2 WL Hy-Line SCDT95 2 WL Hy-Line SC

COH RP9 2/15 WL Line 15I5 x 72RECC-6348 15 WL UCD007RECC-COH2 21 AUS UCD100

Table 1 (continued)

410

DT40 CRL-2111), LSCC-DT95 (ATCC DT95 CRL-2112).Development of the various cell lines is reviewed inNazerian (1987); Schat et al. (1991), and Himly et al.(1998). DNA and description of cell lines RECC-6348 andRECC-COH2 was obtained from M Miller (unpublished).

Genotyping

PCR was done using 50 ng of genomic DNA, with 5 pmolof each primer, 1.5 mM of MgCl2, and 0.25 units of Taq(Sigma, St. Louis) in manufacturer’s PCR buffer in a finalvolume of 20 ul. Initial denaturation for 1 min at 94°Cwas followed by 35 cycles of 92°C for 45 s, 57°C for45 s, 72°C for 45 s, followed by a 1.5-h extension at72°C. PCR primers for LEI0258 are CACGCAGCAGAACTTGGTAAGG forward and AGCTGTGCTCAGTCCTCAGTGC reverse as described by McConnell et al.(1999) (GenBank Z83781). For MCW0371, PCR primersare CTGCTCCGAGCTGTAATCCTG forward and TTTCATGGCATCCTAAGATG reverse (primer sequenceskindly provided by Jan van der Poel). Figure 1 is aschematic of the chicken MHC indicating the relativelocations of LEI0258 and MCW0371.

The forward LEI0258 primer was dye-labeled witheither 6-Fam to produce a fluorescently labeled PCRproduct detectable on an ABI 377 DNA sequencer(Applied Biosystems, Foster City, CA, USA) or with LS-Blue (Synthegen, Houston, TX, USA) for detection on aCEQ8800 (Beckman-Coulter, Fullerton, CA, USA). Frag-ment sizes were determined using Genotyper2 softwarefrom ABI or CEQ 8800 fragment analysis software fromBeckman-Coulter.

PCR and sequencing

DNA sequence was obtained using primers that bind justoutside of the LEI0258 binding region; thus, sequencewas acquired for the entire region encompassed by theLEI0258 primers. These primers are TCGGGAAAAGATCTGAGTCATTG forward (CAJF01F) and TGATTTTCAGATCGCGTTCCTC (CAJF01R) for the reversedirection. Five microliters of the product from theCAJF01F and CAJF01R PCR reaction were exonuclease-treated with 2 ul of a 1:10 dilution of ExoSAP-IT (USB,Cleveland, OH, USA) for 3 h to remove any residualprimer followed by heat inactivation for 15 min. Onemicroliter of this exonuclease reaction product was thenadded to one half of the reaction product of Big-Dye 2terminator sequencing mix (Applied Biosystems, FosterCity, CA, USA) along with 3.2 pmol of either the forwardor the reverse sequencing primer. The PCR cyclesconsisted of 25 cycles of 96°C for 20 s, 50°C for 20 s,and 60°C for 4 min; the reaction products were isolated byalcohol precipitation as per manufacturer’s instructions.The products were rinsed twice with ethanol, resuspendedin HiDi formamide (Applied Biosystems, Foster City, CA,USA), and analyzed using a 50-cm array on an ABI 3100DNA genetic analyzer. Each DNA sample was sequencedtwice in the forward and twice in the reverse direction.Most of the defined haplotypes from within each line weresequenced twice if two homozygous individuals wereavailable. Thus, the consensus sequence for each haplotypewithin a line was derived from eight independent sequencingreactions. Sequence information was obtained for 71 of the98 haplotypes. The LEI0258 alleles were sequencedbecause of its high level of polymorphism and largerange in allele sizes. DNA sequence was not obtained for

Source Line B haplotype Breed Origin Sequence

COR CU17 19 WL Cornell PCU147 13 WL Cornell S13

A All haplotypes for which LEI0258 allele sequence information was obtained, UCD University of California-Davis (Davis, CA, USA), NIUNorthern Illinois University (DeKalb, IL, USA), UNH University of New Hampshire (Durham, NH, USA), DIAS Danish Institute ofAgricultural Sciences (Tjele, Denmark), ADOL Avian Disease and Oncology Lab (East Lansing, MI, USA), ISU Iowa State University(Ames, IA, USA), HYL Hy-Line International (Dallas Center, IA, USA), ATCC American Type Culture Collection (Manassas, VA, USA),COH City of Hope National Medical Center (Duarte, CA, USA), COR Cornell University (Ithaca, NY, USA), ANC Ancona, AUSAustralorp, CJF Ceylonese Jungle Fowl, FAY Fayoumi, NH New Hampshire, RIR Rhode Island Red, RJF Red Jungle Fowl, SP Spanish,WC White Cornish, WL White Leghorn, WPR White Plymouth Rock

Table 1 (continued)

~10-20 BG

B30

.1B

30.2

DM

A

TAP

1

C4

His

tone

H3

Ble

c1

RIN

G3

BF1

TAP

2

BG

1

Tapa

sin

DM

B1

BF

2

DM

B2

BLB

2

LEI0

258

Leu-

tRN

AB

lec2

(Nkr

)B

LB1

MC

W03

71

AL023516 (92Kb)

10, 560 bp

19 genes of Kaufman et al 1999

Y NOR BLAB

BFBL

Fig. 1 The chicken major histocompatibility complex map (revisedfrom Miller et al. 2004) showing the location of markers LEI0258and MCW0371. Cosmid cluster 1 (Kaufman et al. 1999) sequencedgenes are indicated

411

MCW0371 as it had relatively few alleles and behaved likea typical mono-repeat as predicted from sequence.

Gel electrophoresis

PCR products were separated on a 4% agarose gel. Fivemicroliters of PCR product was mixed with 1 ul of loadingdye (bromophenol blue with glycerol) and loaded in eachwell. Electrophoresis was done at 60 V for 3 h at 10°C.

Results

Figure 2 shows gel electrophoresis separation of theLEI0258 alleles from various haplotypes. A 100-bp ladderwas used in the first and last wells of the gel. Sizedifferences between haplotypes are very apparent andrange from less than 200 bp for B4 to more than 500 bp forB19. It was these obvious differences in allele sizedetectable by rapid and inexpensive methods that promptedthe investigation of association between LEI0258 allelesize and MHC haplotype. For more accuracy, allele sizeestimation was done using fragment separation on DNAsequencing equipment. This provides more accurate sizesand better resolution of small size differences.

The allele sizes obtained for both LEI0258 andMCW0371 for the different haplotypes were sorted byLEI0258 allele size and summarized in Table 2. A total of26 alleles, ranging from 182 to 552, were identified forLEI0258. This is a considerable greater size diversity thanexpected for a simple sequence repeat. The microsatelliteMCW0371 had eight different alleles identified, rangingfrom 200 to 209, generally in 1-bp increments as expectedfor a simple monomeric repeat. For those LEI0258 allelesthat were not sequenced, sizes were extrapolated from thegenotype data and indicated in the table.

Standard haplotypes

The haplotypes B1–B29 are considered to be the standardhaplotytpes, most of which were derived from the WhiteLeghorn breed. They were first defined by Briles et al.(1982) and their definitions were recently updated in Milleret al. (2004). The LEI0258 allele size alone can distinguishmost of these haplotypes. Those haplotypes from geneti-cally different populations that were considered to beserologically identical had the same allele size for bothmarkers. For example, B2 was obtained from sevendifferent sources; all seven sources had an LEI0258 alleleof 261 and an MCW0371 allele of 206. This consistentallele size from serologically identical samples fromdiverse populations was seen for the other standardserologically well-defined haplotypes including B5, B6,B12, B13, B15, B19, B21, and B24. The B24 haplotypewas derived from the New Hampshire breed, whereas allothers originated from White Leghorns.

The B2 and B15 haplotypes are very common and easilydefined by serology. Both of these alleles had the identicalallele size of 261 for LEI0258. Subsequent analysis of thesequence of each allele revealed that they were identical(Table 3); however, their MCW0371 allele differed(B2=206, B15=203) such that these two haplotypes couldbe distinguished with this additional information. Onehundred offspring from matings known to be segregatingfor B2 and B15 were serotyped with specific alloantiserathat distinguished the two haplotypes. These same birdswere also genotyped for LEI0258 and MCW0371. Therewas complete concordance between genotype identified byserology and by MCW0371 allele, confirming the value ofthe latter in discriminating between B2 and B15 (data notshown).

B13 and B17 are serologically distinct, yet theirLEI0258 allele size is identical (205 bp). Sequence analysisrevealed a single SNP difference between these twoLEI0258 alleles. MCW0371 allele size differed by 3 bp,with B13 at 202 bp and B17 at 205 bp. The B19 haplotypehas historically been separated into two haplotypes that

Fig. 2 Marker LEI0258 PCRproduct separation and sequencesize for different chicken majorhistocompatibility complexhaplotypes

412

Table 2 Allele sizes for markers LEI0258 and MCW0371 tested in chicken genetic stocks and cell lines

LEI0258 MCW0371 B haplotype Line Source

182 202 4 4 DIAS193 200 15.1 GH15.1 ISU193 201 11 Wisc3 NIU193 201 61 Commercial HYL193 205 27 NIU NIU194 203 BW3 13 DIAS205 202 13.2 133 DIAS205 202 13 15.P-13 ADOL205 202 13 GH13 ISU205a 202 13 NIU NIU205a 202 13 GHs13 ISU205 205 17 UCD380 UCD205 206 BW11 11 DIAS247 203 18 UCD253 UCD249 206 15.2 M15.2 ISU249 206 22 UNH105 UNH249 206 73 Commercial HYL249a 206 73 Commercial HYL261 203 15 22 DIAS261 203 15 15I5 ADOL261 203 15 Commercial HYL261a 203 15 UCD254 UCD261a 203 15 HN15 ISU261a 203 15 Commercial HYL261 206 2 15.6-2 ADOL261 206 2 15.7-2 ADOL261 206 2 Commercial HYL261 206 2 Commercial HYL261a 206 2 UCD331 UCD261a 206 2 NIU NIU261a 206 2 32 DIAS261 206 29 NIU NIU261a 206 29 Commercial HYL295 209 5 15.15I-5 ADOL295 209 5 Commercial HYL295 209 11.1 Wisc3 NIU295a 209 5 NIU NIU307 208 72 Commercial HYL307a 208 72 Commercial HYL307 208 78 Commercial HYL309 205 10 Commercial HYL309 205 24 UCD312 UCD309 205 24 UNH105 UNH309 205 24 Commercial HYL309 205 26 UNH105 UNH309a 205 76 Commercial HYL321 202 74 Commercial HYL333 201 BW4 14 DIAS345 201 14 34 DIAS357 205 5.1 M5.1 ISU357 205 6.1 NIU NIU357 205 21 UCD330 UCD357 205 21 15.N-21 ADOL357 205 21 Commercial HYL

413

LEI0258 MCW0371 B haplotype Line Source

357 205 75 Commercial HYL357 205 B130 130 DIAS357 205 B131 131 DIAS357 205 B201 201 DIAS357a 205 1.1 S1-1H ISU357a 205 21 NIU NIU357a 205 21 21 DIAS357a 205 21 Commercial HYL357a 205 75 Commercial HYL357 206 23 UNH105 UNH357a 208 77 Commercial HYL367 202 C UCD342 UCD369 205 21.1 SP21.1 ISU369 205 Q UCD336 UCD369 205 BW1 111 DIAS381 206 13.1 Commercial HYL393 206 1 GH1 ISU405 206 8 Wisc3 NIU405a 206 1 S1-1L ISU405a 206 1.2 S1-1L ISU420 205 62 Commercial HYL443 205 6 36 DIAS443 205 6 GHs6 ISU474 205 12.2 HN12 ISU474 205 71 Commercial HYL487 205 12 15.C-12 ADOL487 205 12 Commercial HYL487a 205 12 2 DIAS487a 205 12 Commercial HYL487a 205 12.1 HN12 ISU513 205 12.3 NIU NIU539 205 19 15.P-19 ADOL539 205 19 Commercial HYL539 205 19 Commercial HYL539a 205 19 NIU NIU539a 205 19 21 DIAS552 205 19.1 UCD335 UCD552 205 19.1 39 DIAS552 205 19.1 131 DIAS552 205 19.1 S1-19H ISU552 205 19.1 S1-19L ISUCell lines261a 206 2 DT40 ATCC261a 206 2 DT95 ATCC261a 203/206 2/15 RP9 ADOL261a 206 2/15b RP2 ADOL261a 203/206 2/15 RP9 COH261a 203 15 RECC-6348 COH357a 205 21 RECC-COH2 COH357a 205 21 DF1 ADOL539a 205 19 CU17 COR

UCD University of California-Davis (Davis, CA, USA), NIU Northern Illinois University (DeKalb, IL, USA), UNH University of NewHampshire (Durham, NH, USA), DIAS Danish Institute of Agricultural Sciences (Tjele, Denmark), ADOL Avian Disease and OncologyLab (East Lansing, MI, USA), ISU Iowa State University (Ames, IA, USA), HYL Hy-Line International (Dallas Center, IA, USA)aNot sequenced, size extrapolatedbCell line fails to bind B15-specific antisera

Table 2 (continued)

414

Table 3 Polymorphisms identified within the LEI0258 and MCW0371 alleles of defined MHC haplotypes tested in chicken genetic stocks

B haplotype Consensussize (bp)

Position R13 R12 Position MCW0371allele size

Uniquegenotype

Genbank accessionnumber−61 −30–29 −28 −11 5 23–29 33 39 46

Δ TT G G C ATTTGAG Δ A T

4 182 – – – A 1 2 – Δ A – – 202 * DQ23954015.1 193 – – – – 1 3 T Δ – – – 200 * DQ23951211 193 – – – – 1 3 T Δ – – – 201 DQ23949561 193 – – – – 1 3 T Δ – – – 201 DQ23954727 193 – – – – 1 3 T Δ – – – 205 * DQ239538BW3 194 – – – A 1 3 – Δ A – – 203 * DQ23956113 205 – – – – 1 4 T Δ – – – 202 * DQ239501

DQ239502DQ239503

13.2 205 – – – – 1 4 – Δ – – – 202 * DQ23950517 205 – – – – 1 4 – Δ – – – 205 * DQ239514BW11 205 – – – – 1 4 – Δ – – – 206 * DQ23956018 247 – Δ – – 1 7 – – – – A 203 * DQ23951515.2 249 – – – – 1 7 – – – T – 206 DQ23951322 249 – – – – 1 7 – – – T – 206 DQ23953173 249 – – – – 1 7 – – – T – 206 DQ23955115 261 – – – – 1 8 – – – – A 203 * DQ239509

DQ239510DQ239011

2 261 – – – – 1 8 – – – – A 206 DQ239523DQ239524DQ239525

29 261 – – – – 1 8 – – – – A 206 DQ23953911.1 295 – Δ A – 1 11 – – – – – 209 * DQ2394965 295 – Δ – – 1 11 – – – – – 209 * DQ239541

DQ23954272 307 – Δ A – 1 12 – – – – – 208 DQ23955078 307 – Δ A – 1 12 – – – – – 208 DQ23955510 309 – – – – 1 12 – – – T – 205 DQ23949424 309 – – – – 1 12 – – – T – 205 DQ239533

DQ239534DQ239535DQ239536

26 309 – – – – 1 12 – – – T – 205 DQ23953776 309 – – – – 1 12 – – – T – 205 DQ23955474 321 – – – – 1 13 – – – T – 202 * DQ239552BW4 333 – – – – 1 14 – – – – A 201 * DQ23956214 345 – – – – 1 15 – – – T – 201 * DQ239508130 357 – – – – 1 16 – – – T – 205 DQ239506131 357 – – – – 1 16 – – – T – 205 DQ239507201 357 – – – – 1 16 – – – T – 205 DQ2395265.1 357 – – – – 1 16 – – – T – 205 DQ2395436.1 357 – – – – 1 16 – – – T – 205 DQ23954621 357 – – – – 1 16 – – – T – 205 DQ239527

DQ239528DQ239529

75 357 – – – – 1 16 – – – T – 205 DQ23955323 357 – – – – 1 16 – – – – A 206 * DQ239532C 367 – Δ – – 1 17 – – – – A 202 * DQ23955721.1 369 – – – – 1 17 – – – T – 205 DQ239530Q 369 – – – – 1 17 – – – T – 205 DQ239558BW1 369 – – – – 1 17 – – – T – 205 DQ239559

415

have been difficult to reliably distinguish by serology. TheB19 haplotypes separated into two different LEI0258 allelesizes of 539 and 552 bp, which are unique to B19.

More variation in allele size is seen with less well-characterized haplotypes. Three different alleles werefound for the B1 haplotype identified in the various ISUlines. These lines are not completely inbred and aredifficult to type serologically (Sue Lamont, personalcommunication). Other sets of serologically similarhaplotypes such as B15, B15.1, and B15.2 had uniqueallele sizes for both markers.

The less studied haplotypes were derived from variousbreeds including Red and Ceylonese Jungle Fowl, Ancona,White Plymouth Rock (WPR) , White Cornish, Fayoumi,and Spanish breeds. The two markers were useful indistinguishing these haplotypes also, and many uniquealleles were identified.

NH- and WPR-derived commercial brown egg layerstocks provided the serologically different haplotypesB71–B78. Within these lines, there were six distinctserologic haplotypes, plus two additional LEI0258 allelesin very low frequency. This resulted in a total of eightdistinct LEI0258 alleles. Six of these allele sizes werefound in other haplotypes outside these commercial stocks.

Allelic variability

From the 98 distinct samples that were genotyped, therewere a total of 26 different allele sizes identified forLEI0258 (Table 2). The most common allele size foundwas 357, found in ten different haplotypes, originatingfrom six different breed sources. The most well-definedhaplotype with the 357 allele is B21. The B21 haplotype isknown to confer resistance to MDV (Hansen et al. 1967;Briles et al. 1977; Bacon et al. 1981). This advantage of theB21 MHC haplotype may have contributed to its preva-lence in both select laboratory lines as well as numerousbreeds. The allele 193 was also very widely dispersed,being found in four different haplotypes (including B11),representing three different breeds. It is interesting that theB11 haplotype is also known to confer resistance to MDV(Wakenell et al. 1996). This commonality of some allelesbetween different breeds indicates that the LEI0258 allelesare not breed specific.

For simplicity, the values obtained from sequenceinformation were provided. Use of different platforms forgenotype analysis will result in slight variation in estimatedallele sizes. All haplotypes were genotyped, but not all

B haplotype Consensussize (bp)

Position R13 R12 Position MCW0371allele size

Uniquegenotype

Genbank accessionnumber−61 −30–29 −28 −11 5 23–29 33 39 46

Δ TT G G C ATTTGAG Δ A T

13.1 381 – – – – 1 18 – – – T – 206 * DQ2395041 393 – – – – 1 19 – – – T – 206 * DQ2394938 405 – – – – 1 20 – – – T – 206 * DQ23955662 420 – – – – 16 5 – – – – – 205 * DQ2395486 443 – – – – 15 8 – – – – – 205 * DQ239544

DQ23954512.2 474 – – – – 22 3 – – – – – 205 * DQ23949971 474 A – – – 22 3 – – – – – 205 * DQ23954912 487 – – – – 23 3 – – – – – 205 * DQ239497DQ23949812.3 513 – – – – 25 3 – – – – – 205 * DQ23950019 539 – – – – 27 3 – – – – – 205 * DQ239516

DQ239517DQ239518DQ239519DQ239520

19.1 552 – – – – 28 3 – – – – – 205 * DQ239521DQ239522

Table 3 (continued)

-1

1

R13 R12

d-61

d-30-29

-28

-11 5

d23-29

39

d33 46Repeat Structure

-78

88

Fig. 3 Schematic of the repeatstructure and location of SNPand deletions within theLEI0258 locus

416

were subsequently sequenced. For non-sequenced alleles,sizes provided were extrapolated from the genotype results.

Molecular genotyping

Based on size alone, 26 alleles for LEI0258 were identified.Several groups of haplotypes with identical LEI0258 sizeand sequence can be further resolved with the additionalpolymorphism of MCW0371. The LEI0258 allele size of193 was found for four haplotypes, which could beresolved further by their three different MCW0371 allelesizes. By combining information from both LEI0258 andMCW0371 markers, 34 distinctive haplotypes were

identified. The addition of SNP information fromLEI0258 resolves an additional haplotype for a total of 35.

Cell line genotypes

The allele sizes obtained for each cell line for LEI0258 andMCW0371 are also shown in Table 2. The allele sizesobserved were consistent with the given haplotype for allcell lines tested except for RP2. This cell line was reportedto be B2/B15 (Nazerian 1987) but MCW0371 markeranalysis showed the 206 allele of B2 without the 203 alleleof B15. Subsequent flow cytometric analysis of the cell linerevealed that this cell line binds B2-specific antisera, but

Fig. 4 HyPhy-ClustalW analy-sis of sequences from 41LEI0258 alleles. Neighbor-joining trees were calculated byusing phylogenetic reconstruc-tion analysis using a full-like-lihood distance computation andthe general reversible modelwith 100 iterations

417

not B15 antisera (H.D. Hunt, personal communication),and thus by serological testing does not contain the B15haplotype.

Basis of LEI0258 polymorphism

The LEI0258 alleles show considerable diversity in sizenot expected for the typical microsatellite marker. Se-quence information of the repeat region plus the twoflanking regions surrounding the repeat are summarized inTable 3. The entire LEI0258 allele was sequenced,numbered from −78 to −1 for the region immediatelyupstream of the repeat, and numbered from 1 to 88 for theregion including the last repeat and downstream throughthe reverse primer. The repeat region consists of twoindependent repeat elements, a 13-bp repeat of“CTATGTCTTCTTT” and a 12-bp repeat of “CTTTCCTTCTTT”. These repeats were replicated from 1 to 28times for the R13 repeat and from 2 to 20 times for the R12repeat. A schematic of the relative positions of theserepeats plus locations of the other polymorphisms foundwithin LEI0258 are shown in Fig. 3.

In addition to the variation in the number of copies of theR13 and R12 repeats, nine polymorphisms were observedwithin the flanking sequences. For continuity, the mostcommonly observed base at a given position was referredto as the consensus sequence. Four polymorphisms wereobserved in the region upstream of the repeat structure: twoinsertion or deletion polymorphisms (indels) and twoSNPs. Five polymorphisms were observed in the regiondownstream of the repeat structure: two indels and threeSNPs. All of these variations are found in multiple

haplotypes except for one. The A insertion 61-bp upstreamof the repeats was found only for the B71 haplotype.

Cluster analysis and sequence relationships

The complete sequences of the LEI0258 locus for each ofthe 51 haplotypes were assembled in fasta format andaligned using HyPhy-ClustalW and the method ofneighbor-joining on the distance matrix resulting fromthe calculated distances (percent divergence) between allpairs of sequence within the multiple alignment (Pond et al.2005). Using this data, HyPhy constructs an unrooted treedescribing the relationships between the sequences con-tained within the alignment. The branch lengths of the treerepresent the distance (percent divergence). The root of thetree assumes a degree of constancy in the ‘molecular clock’and estimates the common “ancestor” sequence from thederived “progeny” sequences.

The tree resulting from this analysis is presented inFig. 4, with three main clades of sequence clusters. Theseclades consist of haplotypes where the R13 repeat isexpanded (15–28 copies), R12 repeat is expanded (7–20copies), and SNPs have been introduced in haplotypes withtwo to four copies of the R12 repeat. These three mainbranches are denoted branches I, II, and III, respectively.The subbranches within each of these three groupsrepresent the SNP clusters. Haplotypes with commongenotypes for all of the sequence-based polymorphismslocated within the LEI0258 locus are located on commonvertical lines within the tree. The addition of genotypeinformation from MCW0371 in clade II allows for finerdifferentiation of the haplotypes (Fig. 5).

Discussion

In this report, we describe an alternative to serotyping forMHC B locus haplotype determination using molecularapproaches based on differences due to tandem repeatlength, indels, and single nucleotide polymorphisms inmarkers LEI0258 and MCW0371. Development of sero-logical reagents for MHC haplotype determination can be acomplex and time-consuming process especially in non-inbred populations. The process of developing thesereagents and characterizing and interpreting the agglutina-tion results requires extensive pedigreed families, access tonumerous birds, and multiple MHC haplotypes. Theseresources and this expertise are no longer accessible inmost locations.

Haplotype determination by serology currently requiresavailability of reagents capable of distinguishing eachhaplotype. Cells from known haplotypes and well-characterized reagents must be exchanged and tested forcomparisons among labs. These exchanges of biologicalmaterials are becoming increasingly difficult because ofbiosecurity concerns. For this very reason, wide cross-comparisons between the various stocks from differentcountries have not been done recently. The alternative of

Fig. 5 Clade II with additional information from MCW0371.Neighbor-joining trees were calculated by using phylogeneticreconstruction analysis using a full-likelihood distance computationand the general reversible model with 100 iterations

418

MHC typing by molecular sequence analysis relies simplyon electronically exchanged information such as primersequences, reaction conditions, and allele sizes. For thisproject, an attempt was made to gather all of the MHChaplotypes as defined by Briles et al. (1982) and to evaluatethem for sequence polymorphism in DNA markers that liewithin the B region. Unfortunately, some of these referencehaplotypes and lines could not be located and may nolonger exist. Additional serologically defined haplotypesfrom commercial egg production lines were evaluated todetermine the stability of this DNA marker in much largerpopulations and to determine if this marker would havepractical applications.

Traditional serology for MHC identification has severallimitations, including subjectivity in interpretation ofserological reactions and expertise required for productionof new reagents. Molecular polymorphisms can also beuseful to identify heterozygotes within a family anddetermine how immunizations should be done for produc-tion of antisera. If some reagents are available but havehigh levels of cross reactivity, molecular polymorphismwould be useful to determine if there are additional orpreviously unidentified rare or novel B locus allelespresent. Serological testing of individuals is significantlymore rapid and less expensive than the numerous steps ofDNA isolation and subsequent genotyping required formolecular determination. However, the cost and timeinvolved in serological reagent development may offsetthis difference. Molecular genotyping would be invaluablein the initial identification of different haplotypes forantisera development. In cases where a complete set ofreagents is not available, new serotypes may be missed.Molecular typing is not without its limitations as well, asseveral serologically defined haplotypes contained iden-tical sequence for LEI0258 and, thus, may not bedistinguishable. Addition of the information from theMCW0371 alleles was able to separate many of thesehaplotypes. There may well be other polymorphisms(either microsatellites, SNP, or indels) in other regionsthat could define all haplotypes. Other molecular-basedtechniques for identifying MHC alleles rely directly onpolymorphisms in the actual genes of the MHC, i.e., BF,BL, or BG genes. However, because of the presence ofisogenes and pseudogenes, PCR-based methods for thesegenes result in multiple bands from multiple copies, thuscomplicating interpretation. The DNA markers describedhere do not suffer from these problems as they amplify onlyone allele.

Previous sequence information for the LEI0258 locus fortwo independent samples is available in GenBank. The firstof these samples is from the original submission of theLEI0258 marker locus (accession no. Z83781) byMcConnell et al. (1999). This particular sequence, basedon the current data set for LEI0258 sequences, would beclassified as being from either B17, BW11, or B13.2haplotypes. The second sample, submitted to GenBank in1998, came from a larger genome sequence contig thatcontained 92,863 bp of the MHC B locus and included theLEI0258 region. Comparison of this sequence (accession

no. AL023516) to the sequences for LEI0258 in this studywould classify the clone as coming from a B12 haplotypewhich has 23 R13 repeats and three R12 repeats andconsensus SNP genotypes. This current finding agreedwith the original reference for this sequence, which definedthe source of genomic DNA as being from a B12 individual(Guillemot et al. 1988).

The cell line results confirmed the usefulness of thismethodology for identifying MHC type even in extensivelycultured cell lines. This confirms the stability of each repeatallele, despite multiple cell culture generations. The RP2cell line was an especially interesting exception. In theliterature, this cell line was reported to be derived from atumor from a B2/B15 individual and, thus, should be B2/B15. The flow cytometry results clearly showed that thisline now contains only the B2 haplotype as substantiatedby the MCW0371 results. The original tumor from whichthe cell line was derived either lost or never contained theB15 MHC allele. Chromosomal instability of transformedcell lines makes the former possibility more plausible(Chang and Delany 2004).

The LEI0258 allele size and the R13/R12 repeatstructure shared among several distinct B haplotypesmotivated the effort to completely sequence the LEI0258locus instead of simply sizing the amplification product.The sequence data revealed distinguishing SNP differencesfor some of these haplotypes. In addition, many chickenlines carry the B2 serotype even though they have beengenetically distinct for 40 or more generations. Thesequence information showed allelic identity despite themany generations of separation. Thus, there appears to beno inherent instability in this repeat region, which perhapsis related to the large size of each repeat (i.e., 13 and 12 bp).

Recombination within the chicken MHC is known tohave occurred. Haplotypes found in broiler stocks oftenconsist of BG, BF, or BL regions with sequence identity tothe corresponding regions found in layer stocks, but thecomponents are arranged in unique combinations (Livant etal. 2001). It is thus likely that historical recombinationevents have occurred between LEI0258 and/or MCW0371alleles and the serologically detected gene products of thechicken MHC. Nonetheless, the molecular characterizationof the MHC as defined by these two markers does havesome very practical applications.

The recent publication of the chicken genome draftsequence (Hillier et al. 2004) has provided a valuableresource for accelerating avian genetics and functionalgenomics. One specific limitation of the published se-quence thus far has been the omission of sequence from theMHC region of chicken chromosome 16. Likely due to theexcessive repetitive nature of this region, sequenceassembly of the whole genome shotgun reads has beendifficult to accomplish. The individual red jungle fowl thathad its genome sequenced is from the UCD001 line. TheBQ haplotype sequenced in this report was originallyderived from this line.

Haplotype B13 originated from line GB1 but has beengenetically isolated for more than 40 years in line 133 atDIAS and line GH13 at ISU. During this separation, the

419

LEI0258 allele has acquired a SNP difference, even thoughthe allele size is identical. The B13 variant from line 133 atDIAS was called B13.2. The B13 allele from GHs13 fromISU was not sequenced and was also originally derivedfrom the same GB1 line. It would be interesting todetermine if the GHs13 allele is also beginning to diverge.

For practical implementation of sequence-based haplo-type identification, it must be noted that slight differencesin allele size calling by the Genotyper software will beobserved depending on which internal lane standard sizerange is used. There are also slight differences among thevarious Applied Biosystems genetic analysis platformsABI377, ABI3100, and ABI3700. For absolute certainty asto the amplicon size for a given allele, the amplicon mustbe sequenced, but for routine analysis this option isexpensive. The genotyping platforms work very well,providing controls for known allele sizes; the sameinstrument and internal lane standard are consistently used.

The development of rapid tests for each of thepolymorphisms can be done either as a fragment lengthpolymorphism or allele-specific PCR assay to characterizethe known polymorphic alleles in the LEI0258 andMCW0371 loci. This approach would be significantlyless expensive than sequencing but would limit thediscovery of new polymorphisms.

This research focused on examining LEI0258 allelesfrom serologically defined MHC sources and commercialegg-laying chickens to determine if this marker could beused to discriminate haplotypes. The next step would be toexamine commercial broiler stocks and various otherbreeds not tested here to identify additional alleles. It isquite likely that the “missing” alleles with the 13- and 12-bp repeat structure of 1, 9 and 1, 10 or 24, 3, etc. may befound in these other sources.

Acknowledgements The authors are indebted to the numerousscientists who have maintained these many MHC-defined chickenlines and who willingly provided the material for this study: HDHunt, Avian Disease and Oncology Laboratory, East Lansing, MI,USA; MM Miller, Beckman Research Institute, City of HopeNational Medical Center, Duarte, CA, USA; WE Briles, NorthernIllinois University, DeKalb, IL, USA; KA Schat, Cornell University,Cornell, NY, USA; ME Delany, University of California-Davis,Davis, CA, USA; and SJ Lamont, Iowa State University, Ames, IA,USA. In addition, the assistance of HD Hunt in performing the flowcytometric assay is gratefully acknowledged. The authors areparticularly grateful to Dr. Marcia M. Miller for her enthusiasmand encouragement during the early phases of this project and for herthoughtful and constructive comments on an earlier version of thismanuscript.

References

Bacon LD, Hunt HD, Cheng, HH (2000) A review of thedevelopment of chicken lines to resolve genes determiningresistance to diseases. Poult Sci 79:1082–1093

Bacon LD, Hunt HD, Cheng HH (2001) Genetic resistance toMarek’s disease. Curr Top Microbiol Immunol 255:121–141

Bacon LD, Witter RL, Crittenden LB, Fadly A, Motta J (1981) B-Haplotype influence on Marek’s disease, Rous sarcoma, andlymphoid leucosis virus-induced tumors in chickens. Poult Sci60:1132–1139

Briles WE, Briles RW (1982) Identification of haplotypes of thechicken major histocompatibility complex (B). Immunogenetics15:449–459

Briles WE, Stone HA, Cole RK (1977) Marek’s disease: effects of Bhistocompatibility alloalleles in resistant and susceptiblechicken lines. Science 195:193–195

Briles WE, Bumstead N, Ewert DL, Gilmour DG, Gogusev J, HalaK, Koch C, Longenecker BM, Nordskog AW, Pink JRL,Schierman LW, Simonsen M, Toivanen A, Toivanen P, VainioO, Wick G (1982) Nomenclature for chicken major histocom-patibility (B) complex. Immunogenetics 15:441–447

Buitenhuis AJ, Rodenburg TB, van Hierden YM, Siwek M,Cornelissen SJB, Nieuwland MGB, Crooijmans RPMA,Groenen MAM, Koene P, Korte SM, Bovenhuis H, van derPoel JJ (2003) Mapping quantitative trait loci affecting featherpecking behavior and stress response in laying hens. Poult Sci82:1215–1222

Chang H, Delany ME (2004) Karyotype instability of the DT40 cellB-cell line: macrochromosome variation and cytogenetic mo-saicism. Chromosome Res 12:299–307

Collins WM, Briles WE, Corbett AC, Clark KK, Zsigray RM,Dunlop WR (1979) B locus (MHC) effect upon regression ofRSV-induced tumors in noninbred chickens. Immunogenetics9:97–100

Cotter PF, Taylor RL Jr, Abplanalp H (1998) B-Complex associatedimmunity to Salmonella enteritidis challenge in congenicchickens. Poult Sci 77:1846–1851

Emara MG, Kim H, Zhu J, Lapierre RR, Lakshmanan N, LillehojHS (2002) Genetic diversity at the major histocompatibilitycomplex (B) and microsatellite loci in three commercial broilerpure lines. Poult Sci 81:1609–1617

Fulton JE, Young EE, Bacon LD (1995) Chicken MHC alloanti-serum cross-reactivity analysis by hemagglutination and flowcytometry. Immunogenetics 43:277–288

Goto RM, Afanassieff M, Ha J, Iglesias GM, Ewald SJ, Briles WE,Miller MM (2002) Single-strand conformation polymorphism(SSCP) assays for major histocompatibility complex Bgenotyping in chickens. Poult Sci 81:1832–1841

Guillemot F, Billault A, Pourquie O, Behar, G, Chausse AM,Zoorob R, Kreibich G, Auffray C (1988) A molecular map ofthe chicken major histocompatibility complex: the class II betagenes are closely linked to the class I genes and the nucleolarorganizer. EMBO J 7:2775–2785

Hansen MP, Van Zandt JN, Law GRJ (1967) Differences insusceptibility to Marek’s disease in chickens carrying twodifferent B locus blood group alleles (Abstract). Poult Sci46:1268

Hillier LW, Miller W, Birney E, Warren W, Hardison RC, PontingCP, Bork P, Burt DW, Groenen MA, Delany ME, Dodgson JB,Chinwalla AT, Cliften PF, Clifton SW, Delehaunty KD, FronickC, Fulton RS, Graves TA, Kremitzki C, Layman D, Magrini V,McPherson JD, Miner TL, Minx P, Nash WE, Nhan MN,Nelson JO, Oddy LG, Pohl CS, Randall-Maher J, Smith SM,Wallis JW, Yang SP, Romanov MN, Rondelli CM, Paton B,Smith J, Morrice D, Daniels L, Tempest HG, Robertson L,Masabanda JS, Griffin DK, Vignal A, Fillon V, Jacobbson L,Kerje S, Andersson L, Crooijmans RP, Aerts J, van der Poel JJ,Ellegren H, Caldwell RB, Hubbard SJ, Grafham DV, KierzekAM, McLaren SR, Overton IM, Arakawa H, Beattie KJ,Bezzubov Y, Boardman PE, Bonfield JK, Croning MD, DaviesRM, Francis MD, Humphray SJ, Scott CE, Taylor RG, TickleC, Brown WR, Rogers J, Buerstedde JM, Wilson SA, Stubbs L,Ovcharenko I, Gordon L, Lucas S, Miller MM, Inoko H, ShiinaT, Kaufman J, Salomonsen J, Skjoedt K, Wong GK, Wang J,Liu B, Wang J, Yu J, Yang H, Nefedov M, Koriabine M,Dejong PJ, Goodstadt L, Webber C, Dickens NJ, Letunic I,Suyama M, Torrents D, von Mering C, Zdobnov EM, MakovaK, Nekrutenko A, Elnitski L, Eswara P, King DC, Yang S,

420

Tyekucheva S, Radakrishnan A, Harris RS, Chiaromonte F,Taylor J, He J, Rijnkels M, Griffiths-Jones S, Ureta-Vidal A,Hoffman MM, Severin J, Searle SM, Law AS, Speed D,Waddington D, Cheng Z, Tuzun E, Eichler E, Bao Z, Flicek P,Shteynberg DD, Brent MR, Bye JM, Huckle EJ, Chatterji S,Dewey C, Pachter L, Kouranov A, Mourelatos Z, HatzigeorgiouAG, Paterson AH, Ivarie R, Brandstrom M, Axelsson E,Backstrom N, Berlin S, Webster MT, Pourquie O, Reymond A,Ucla C, Antonarakis SE, Long M, Emerson JJ, Betran E,Dupanloup I, Kaessmann H, Hinrichs AS, Bejerano G, FureyTS, Harte RA, Raney B, Siepel A, Kent WJ, Haussler D, EyrasE, Castelo R, Abril JF, Castellano S, Camara F, Parra G, GuigoR, Bourque G, Tesler G, Pevzner PA, Smit A, Fulton LA,Mardis ER, Wilson RK, International Chicken GenomeSequencing Consortium (2004) Sequence and comparativeanalysis of the chicken genome provide unique perspectiveson vertebrate evolution. Nature 432:695–716

Himly M, Foster DN, Bottoli I, Iacovoni JS, Vogt PK (1998) TheDF-1 chicken fibroblast cell line: transformation induced bydiverse oncogenes and cell death resulting from infection byavian leukosis viruses. Virology 248:295–304

Iglesias GM, Soria LA, Goto RM, Jar A, Miquel MC, Lopez OJ,Miller MM (2003) Genotype variability at the major histocom-patibility complex (B and Rfp-Y) in Camperos broiler chickens.Anim Genet 34:88–95

Juul-Madsen HR, Hedemand JE, Salomonsen J, Simonsen M (1993)Restriction fragment length polymorphism analysis of thechicken B-F and B-L genes and their association withserologically defined B haplotypes. Anim Genet 24:243–247

Juul-Madsen HR, Dalgaard TS, Salomonsen J, Heller ED (2006)Chapter 5, genetic resistance—with focus on major histocom-patibility complex. In: Vainio O (EiC), Eterradossi N, de Wit S,Mundt E, Raue R, van den Berg T (eds) A laboratory manual ofmethods in IBDV and CAV research. http://www.agrsci.dk/media/webdav/filer/sve/smf/genetic_resistance

Kaufman J, Milne S, Gobel TW, Walker BA, Jacob JP, Auffray C,Zoorob R, Beck S (1999) The chicken B locus is a minimalessential major histocompatibility complex. Nature 401:923–925

Kroemer G, Guillemot F, Auffray C (1990) Genetic organization ofthe chicken MHC. Immunol Res 9:8–19

Lamont SJ, Chen Y, Aarts HJM, van der Hulst-van Arkel MC,Beuving G, Leenstra FR (1992) Endogenous viral genes inthirteen highly inbred chicken lines and in lines selected forimmune response traits. Poult Sci 71:530–538

Lamont SJ, Bolin C, Cheville N (1987) Genetic resistance to fowlcholera is linked to the major histocompatibility complex.Immunogenetics 25:284–289

Landesman E, Uni Z, Heller ED (1993) Designation by restrictionfragment length polymorphism of major histocompatibilitycomplex class IV haplotypes in meat-type chickens. AnimGenet 24:349–354

Li L, Johnson LW, Ewald SJ (1997) Molecular characterization ofthe major histocompatibility complex (B) haplotypes in broilerchickens. Anim Genet 28:258–267

Li L, Johnson LW, Livant EJ, Ewald SJ (1999) The MHC of abroiler chicken line: serology, B-G genotypes, and B-F/B-LBsequences. Immunogenetics 49:215–224

Lillehoj HS, Ruff MD, Bacon LD, Lamont SJ, Jeffers TK (1989)Genetic control of immunity to Eimeria tenella. Interaction ofMHC genes and non-MHC linked genes influences levels ofdisease susceptibility in chickens. Vet Immunol Immunopathol20:135–148

Livant EJ, Zheng D, Johnson LW, Shi W, Ewald SJ (2001) Threenew MHC haplotypes in broiler breeder chickens. Anim Genet32:123–131

Livant EJ, Ewald SJ (2005) High resolution typing for chicken BF2(MHC class I) alleles by automated sequencing. Anim Genet36:432–434

McConnell SK, Dawson DA, Wardle A, Burke T (1999) Theisolation and mapping of 19 tetranucleotide microsatellitemarkers in the chicken. Anim Genet 30:183–189

Miller MM, Goto R, Abplanalp H (1984) Analysis of the B-Gantigens of the chicken MHC by two-dimensional gel electro-phoresis. Immunogenetics 20:373–385

MillerMM,Abplanalp H, Goto R (1988) Genotyping chickens for theB-G subregion of the major histocompatibility complex usingrestriction fragment length polymorphisms. Immunogenetics28:374–379

Miller MM, Bacon LD, Hala K, Hunt HD, Ewald SJ, Kaufman J,Zoorob R, Briles WE (2004) 2004 nomenclature for thechicken major histocompatibility (B and Y) complex.Immunogenetics 56:261–279

Nazerian K (1987) An updated list of avian cell lines. Avian Pathol16:527–544

Pisenti JM, Delany ME, Taylor RL Jr, Abbott UK, Abplanalp H,Arthur JA, Bakst MR, Baxter-Jones C, Bitgood JJ, Bradley F,Cheng KM, Dietert RR, Dodgson JB, Donoghue A, Emsley A,Etches R, Frahm RR, Grunder AA, Gerrits RJ, Goetinck PF,Lamont SJ, Martin GR, McGuire PE, Moberg GP, Pierro LJ,Qualset CO, Qureshi M, Schultz F, Wilson BW (2001) Aviangenetic resources at risk: an assessment and proposal forconservation of genetics stocks in the USA and Canada. AvianPoult Biol Rev 12:1–102

Pond SL, Frost SD, Muse SP (2005) HyPhy: hypothesis testingusing phylogenies. Bioinformatics 21(5):676–679

Schat KA, Chen CH, Calnek BW, Char D (1991) Transformation ofT-lymphocyte subsets by Marek’s disease herpesvirus. J Virol65:1408–1413

Sung, AM, Nordskog AW, Lamont SJ, Warner CM (1993) Isolationand characterization of cDNA clones for chicken majorhistocompatibility complex class II molecules. Anim Genet24:227–233

Taylor RL Jr (2004) Major histocompatibility (B) complex controlof response against Rous sarcomas. Poult Sci 83:636–649

Wakenell PS, Miller MM, Goto RM, Gauderman WJ, Briles WE(1996) Association between the Rfp-Y haplotype and theincidence of Marek’s disease in chickens. Immunogenetics44:242–245

Yoo BH, Sheldon BL (1992) Association of the major histocom-patibility complex with avian leukosis virus infection inchickens. Br Poult Sci 33:613–620

Zheng D, O’Keefe G, Li L, Johnson LW, Ewald SJ (1999) A PCRmethod for typing B-LBII family (class II MHC) alleles inbroiler chickens. Anim Genet 30:109–119

Zhou H, Lamont SJ (1999) Genetic characterization of biodiversityin highly inbred chickens lines by microsatellite markers. AnimGenet 30:256–264

421