DOI 10.1007/s00299-012-1236-x Molecular characterization of a Cyrtochilum loxense Somatic Embryogenesis Receptor-like Kinase (SERK) gene expressed during somatic embryogenesis Augusta Cueva • Lorenzo Concia • Rino Cella Abstract Somatic embryogenesis is crucial for the propa- gation of endangered Ecuadorian orchid species, among them Cyrtochilum loxense, in view of the fact that their number in nature or in collections is quite reduced. One of the genes expressed during somatic and zygotic embryogenesis is Somatic Embryogenesis Receptor-like Kinase (SERK). Despite the development of somatic embryogenesis protocols for orchids, no SERK genes have been isolated from this family. This is the first report on the isolation of a full-length orchid SERK sequence, namely that of Cyrtochilum loxense (ClSERK). The identity of ClSERK was inferred by the presence of all domains typical of SERK proteins: a signal peptide, a leucine zipper domain, five LRRs, a serine proline- rich domain, a transmembrane domain, a kinase domain, and the C-terminal region. We have observed that the ClSERK gene is highly expressed in embryogenic calluses generated from protocorms at the time of appearance of embryonic morphological features. At later stages when embryos become well visible on calluses, ClSERK gene expression decreases. Compared to early stages of embryo formation on calluses, the expression detected in leaf tissue is far lower, thus suggesting a role of this gene during development. Keywords ClSERK ! Somatic embryogenesis ! Andean orchids ! Gene expression Abbreviations SERK Somatic Embryogenesis Receptor-like Kinase SE Somatic embryogenesis Introduction Somatic embryogenesis (SE) consists in the reprogram- ming of differentiated somatic cells toward the embryo- genic pathway. It exploits the totipotency of higher plant cells, allowing the regeneration of new plants from some undifferentiated proliferating cells (Chugh and Khurana 2002). Since its discovery in carrot (Reinert 1958; Steward et al. 1958), SE has been described for various plant spe- cies and is considered a useful tool for studying totipotency and basic processes of plant morphogenesis (Gaj 2004). Moreover, it offers the opportunity to clonally propagate in vitro several species, stimulating studies concerning the optimization of in vitro conditions for the regeneration of commercially valuable species. Effective protocols for somatic embryogenesis of orch- ids have been described for some hybrids belonging to Oncidium, Cymbidium, and Phalaenopsis genera (Ishii et al. 1998; Tokuhara and Mii 2001; Chen and Chang 2001, 2006; Huan et al. 2004; Fang-Yi et al. 2006; Su et al. 2006; Chung et al. 2007; Hong et al. 2008). Recently, SE was described also for the Andean orchid Cyrtochilum loxense (Cueva and Gonza ´lez 2009). Somatic embryogenesis involves differential gene expression (Chugh and Khurana 2002). However, the majority of genes differentially expressed in somatic embryos concerns general functions and only few bona fide embryogenesis-specific genes have been identified (Ikeda et al. 2006). Among these, only Somatic Embryogenesis
Transcript
DOI 10.1007/s00299-012-1236-x
Molecular characterization of a Cyrtochilum loxense Somatic Embryogenesis Receptor-like Kinase (SERK) gene expressed during somatic embryogenesis
Augusta Cueva • Lorenzo Concia • Rino Cella Abstract Somatic embryogenesis is crucial for the propa- gation of endangered Ecuadorian orchid species, among them Cyrtochilum loxense, in view of the fact that their number in nature or in collections is quite reduced. One of the genes expressed during somatic and zygotic embryogenesis is Somatic Embryogenesis Receptor-like Kinase (SERK). Despite the development of somatic embryogenesis protocols for orchids, no SERK genes have been isolated from this family. This is the first report on the isolation of a full-length orchid SERK sequence, namely that of Cyrtochilum loxense (ClSERK). The identity of ClSERK was inferred by the presence of all domains typical of SERK proteins: a signal peptide, a leucine zipper domain, five LRRs, a serine proline- rich domain, a transmembrane domain, a kinase domain, and the C-terminal region. We have observed that the ClSERK gene is highly expressed in embryogenic calluses generated from protocorms at the time of appearance of embryonic morphological features. At later stages when embryos become well visible on calluses, ClSERK gene expression decreases. Compared to early stages of embryo formation on calluses, the expression detected in leaf tissue is far lower, thus suggesting a role of this gene during development.
Abbreviations SERK Somatic Embryogenesis Receptor-like Kinase SE Somatic embryogenesis Introduction Somatic embryogenesis (SE) consists in the reprogram- ming of differentiated somatic cells toward the embryo- genic pathway. It exploits the totipotency of higher plant cells, allowing the regeneration of new plants from some undifferentiated proliferating cells (Chugh and Khurana 2002). Since its discovery in carrot (Reinert 1958; Steward et al. 1958), SE has been described for various plant spe- cies and is considered a useful tool for studying totipotency and basic processes of plant morphogenesis (Gaj 2004). Moreover, it offers the opportunity to clonally propagate in vitro several species, stimulating studies concerning the optimization of in vitro conditions for the regeneration of commercially valuable species.
Effective protocols for somatic embryogenesis of orch- ids have been described for some hybrids belonging to Oncidium, Cymbidium, and Phalaenopsis genera (Ishii et al. 1998; Tokuhara and Mii 2001; Chen and Chang 2001, 2006; Huan et al. 2004; Fang-Yi et al. 2006; Su et al. 2006; Chung et al. 2007; Hong et al. 2008). Recently, SE was described also for the Andean orchid Cyrtochilum loxense (Cueva and Gonzalez 2009).
Somatic embryogenesis involves differential gene expression (Chugh and Khurana 2002). However, the majority of genes differentially expressed in somatic embryos concerns general functions and only few bona fide embryogenesis-specific genes have been identified (Ikeda et al. 2006). Among these, only Somatic Embryogenesis
Receptor-like Kinase (SERK) was shown to be a specific marker, able to distinguish individual embryo-forming masses in induced carrot suspension cultures (Schmidt et al. 1997).
The SERK gene was first isolated from carrot somatic embryos (Schmidt et al. 1997). Homologs of DcSERK were isolated from different species. For instance, gene families of five and six members were described, respectively, in Arabidopsis thaliana (AtSERK1-5) and Medicago trunca- tula (MtSERK1-6) (Hecht et al. 2001; Nolan et al. 2011). The AtSERK family is divided into two subfamilies, gen- erated from an ancestral gene duplication event. The first subfamily comprises AtSERK1 and AtSERK2, while the second comprises AtSERK 3-5 (He et al. 2007; Albrecht et al. 2008).
In monocots, the SERK gene family has three members in maize (ZmSERK1-3) (Baudino et al. 2001), two in Oryza sativa (OsSERK1-2) (Ito et al. 2005), three in Triticum aestivum (TaSERK1-3) (Singla et al. 2008), and one in Cocos nucifera (Perez-Nu n ez et al. 2009).
Receptor-like kinases (RLKs) belong to a large group of proteins fundamental for signal transduction in plants. The RLK gene family of Arabidopsis includes 600 genes, while that of O. sativa has more than 1,100 members (Shiu and Bleecker 2003; Shiu et al. 2004). The distinct domains of RLKs include: an N-terminal signal peptide, a single transmembrane domain, a cytoplasmic protein kinase domain with serine/threonine specificity, and an extracellular receptor domain (ECD) (Tichtinsky et al. 2003). The ECD binds to a signal molecule that triggers autophosphorylation as well as phosphorylation of sub- strate proteins inducing specific responses. Based on ECD sequence, RLKs are divided into several groups. The largest group includes Leu-rich-repeat RLKs (LRR- RLKs), characterized by tandem repeats of a Leu-rich consensus sequence, while other groups comprise: S-domain-RLKs, epidermal growth factor (EGF) receptor, extracellular lectin-type proteins (Lec-RLKs) and patho- genesis-related (PR) proteins (Becraft 1998; Shiu and Bleecker 2003).
SERK proteins belong to the LRR-RLK family of plant protein kinases (Walker 1994) and possess two distinctive features: a proline-rich domain called the Ser-Pro-Pro motif (SPP) and five Leu-rich repeats (LRRs). Other SERK protein conserved domains include an N-terminal signal peptide, an extracellular domain consisting of a putative Leu zipper (ZIP), a single trans-membrane domain, a Ser- Thr kinase domain, and a C-terminal leucine-rich domain.
A relationship between SERK1 gene expression and embryogenic competence was observed in Arabidopsis seedlings over-expressing AtSERK1 that were shown to exhibit a three- to fourfold increase in the rate of somatic embryogenesis (Hecht et al. 2001). Expression of an SERK
gene, associated with the induction of somatic embryo- genesis, was also reported for some monocot species (Somleva et al. 2000; Hu et al. 2005; Singla et al. 2008). Moreover, Santos et al. (2009) showed that transgenic lettuce plants expressing an antisense SERK gene were characterized by reduced ability to form somatic embryos and increased resistance to fungal infection, thus suggest- ing the involvement of SERK in both somatic embryo- genesis and plant defense.
Cyrtochilum loxense (Lindl.) Kranzl. is an endemic orchid species distributed in the high Andean forest of southern Ecuador (Loja province). This species was cata- logued as vulnerable in the Red List of Endemic Plants of Ecuador (Endara 2000). At present, considering the few populations in nature and the rapid loss of habitats in Ecuador, this species is critically endangered.
Andean orchids are usually propagated in vitro through either seed germination and subsequent protocorm devel- opment, or shoot regeneration from different explants. Due to reduction of natural populations, seed availability is declining. In addition, problems related to the behavior of pollinators have caused self-incompatibility and seed abortion (Singer 2003). With regard to in vitro propagation techniques, the reported efficiency is low as it produces only a few shoots per explant (Condemarın-Montealegre et al. 2007). For these reasons, it was anticipated that due to efficient production of somatic propagules as reported for other species, SE could be an effective tool for propagating those endangered species whose natural population is declining and the number of individuals in the collection is limited.
Somatic embryos of some orchids were produced from leaf tissues at a rate ranging from 10 to 35 propagules per explant (Chen and Chang 2001, 2002, 2003; Hong et al. 2008). Although C. loxense leaf explants failed to form embryos in the presence of different concentrations and/or combinations of auxins and cytokinins (our unpublished data), an effective SE protocol from protocorms was established (Cueva and Gonzalez 2009). However, the availability of protocorms depends on seeds that are in short supply. For this reason, it was deemed important to better characterize the molecular bases of C. loxense SE as a precondition to improve its efficiency and possibly use leaf explants also with this species.
Since orchid SERK genes were not available, it was decided to isolate a C. loxense SERK ortholog and analyze its expression in embryogenic cells. This basic information was considered useful to identify embryogenesis-compe- tent tissues to improve the propagation of this endangered orchid.
In this study, we describe isolation and molecular characterization of the SERK1 gene of the Andean orchid C. loxense.
Materials and methods
Plant material
Protocorms of C. loxense were obtained from seeds grown in vitro on 1/2 MS medium as described by Cueva and Gonzalez (2009).
Somatic embryogenic calluses were obtained from protocorms cultured on the induction medium (0.045 µM TDZ + 0.038 µM 2,4-D).
RNA extraction and cDNA synthesis
Total RNA extraction from C. loxense embryogenic calluses was carried out using the Aurum Total RNA Fatty and Fibrous Tissue Kit (BioRad) according to the manufacturer’s instructions. Following DNase I digestion performed on- column, RNA was eluted in a final volume of 40 µl. RNA samples (5 µl) were analyzed by 1% agarose gel electro- phoresis, and their concentration was determined using a NanoDropTM 1000 Spectrophotometer (Thermo Scientific).
DNA contamination of total RNA was assessed by amplifying actin9 genomic DNA using a 1-µl aliquot (Shu- Hua et al. 2005). cDNA was synthesized from 1µg of total RNA using the Im Prom-II TM Reverse transcription sys- tem (Promega) according to the manufacturer’s instruc- tions, excluding the RNasin Ribonuclease Inhibitor step.
Cloning of ClSERK To isolate the SERK cDNA of C. loxense, we performed two rounds of RT-PCR with purified total RNA using degenerate primers (Table 1) designed on conserved SERK regions (Baudino et al. 2001). Both PCR reactions were carried out in an Eppendorf Mastercycler in a 20-µl final volume using HotStar HiFidelity Polymerase kit (QIA- GEN). The mixture was denatured at 95"C (5 min) and subjected to 35 amplification cycles (95"C for 30 s, 45"C for 30 s, 72"C for 2 min) with a final extension cycle of 10 min at 72"C. A first PCR performed with primer pairs S1/S3 and S1/S4 did not produce a single band. Therefore, a second touch-up PCR was repeated with primer pair S1/ S3 using as template the product (1 l) of the first S1/S3 PCR: initial denaturation at 95"C (5 min), 10 ‘‘touch-up’’ cycles with denaturation of 95"C for 30 s, an initial annealing temperature of 40"C for 30 s (with an increase to the annealing temperature of 1"C each two cycles) and elongation at 72"C for 2 min, followed by 20 cycles with an annealing temperature of 45"C and a final extension step at 72"C for 5 min. This touch-up PCR generated a frag- ment of 1.2 kb, which was purified using the Wizard# SV Gel and PCR Clean-Up System (Promega), and cloned in pJET1.2 (Fermentas). The resulting sequences were used as queries for a search in GenBank and EMBL databases using the BLAST algorithm (Altschul et al. 1997).
Table 1 Details of primers used in this study
Description Forward Reverse
Baudino et al. (2001) degenerated primers S1 50 TGTHACRTGGGTRTCCTTGTARTCCAT30
S3 50 GTGAAYCCTTGCACATGGTTYCATGT30
S4 50 CCMTGYCCIGGATCTCCCCCITTT30
Positive control Actin (Shu-Hua et al. 2005) 50 GGCTAACAGAGAGAAGATGACC30 50 AATAGACCCTCCAATCCAGAC30
(Hou and Yang 2009) 50 GGATTAGGCTCTCTGCTGTTGG30 50 GTGTGGATAAGACGCTGTTGTATG30
Actin9 amplification was used as an internal control for
all PCR reactions, using primers designed on the sequence of Oncidium Sharry Baby ‘OM8’ (Table 1) (Shu-Hua et al. 2005).
Rapid amplification of cDNA ends (RACE)
In order to obtain the full open reading frame (ORF) of ClSERK, we carried out the amplification of 50 and 30 untranslated regions (UTRs). The amplification of 50 UTR was done using a 50 RACE kit (Invitrogen) according to the manufacturer’s instructions. The first cDNA strand was synthesized with a gene-specific primer (ClSERK-GSP1, Table 1) using a ∼4-µg aliquot of total RNA extracted from embryogenic calluses. The first 50 UTR amplification step was carried out in an Eppendorf Mastercycler using the gene-specific primers (ClSERK-GSP2, Table 1) fol- lowed by a nested PCR using a second gene-specific primer (ClSERK-GSPN3, Table 1).
The 30 UTR was amplified with the 30 RACE kit (Invit- rogen) using the total RNA (∼4 µg) according to the manufacturer’s protocol except for extension temperature (50"C). ClSERK-GSP4 (Table 1) was used as the gene- specific primer for a first PCR. This was followed by a second amplification using a second nested specific primer (ClSERL-GSPN5, Table 1). dNTPs were added to both PCR reaction mixtures at 80"C. Amplification products were purified by Wizard# SV Gel and PCR Clean-Up System (Promega), cloned in pGEM-T Easy (Promega), and sequenced.
Protein sequence and phylogenetic analyses
The predicted protein sequence was analyzed by searching for conserved motifs using CCD database (Marchler-Bauer et al. 2009). The presence of a signal peptide was con- firmed by Signal P3.0 (Jannick et al. 2004). Protein pre- dictions were performed using the PSORT (Prediction of Protein Sorting Signals and Localization Sites in Amino Acid Sequences) (http://psort.nibb.ac.jp/; Nakai and Kanehisa 1992) and Scan Prosite (Hofmann et al. 1999).
To analyze the relationship between the ClSERK and known SERK genes of other species, an alignment was performed using CLUSTALX version 2.0.11 (Larkin et al. 2007) with the Gonnet series as protein matrix, and parameters set to 10 gap open penalty, 0.2 gap extension penalty and divergence sequences delayed at 30%. The phylogenetic tree was constructed using the neighbor- joining (NJ) method, as provided by the program NEIGHBOR of the PHYLIP package version 3.69 (Saitou and Nei 1987). For tree reconstruction, the PHYLIP pro- gram PROTDIST using the PAM model of amino acid transition estimated the distance matrix. To evaluate
statistical significance of the phylogenetic tree, 1000 bootstrap replicates were generated using the PHYLIP program SEQBOOT. ClSERK expression analysis Specific primers used for ClSERK expression analysis were RT-SERK-Fw and ClSERK-GSP2 (Table 1) that amplify a fragment of 223 bp. To prevent an unwanted contribution by contaminating genomic DNA, the primers were designed so as to overlap the boundary of two adjacent exons. RNA extraction and cDNA synthesis were carried out as described above from 20, 32, and 40-day-old embryogenic calluses plated on 1/2 MS induction medium containing 0.045 µM TDZ + 0.038 µM 2,4-D, and 3-month-old leaves. The relative expression of ClSERK was measured with a Rotorgene TM 6000 thermalcycler, using GoTaq# qPCR Master Mix (Promega). The ampli- fication parameters were as follows: 95"C for 10 min, 1 cycle; 95°C 10 s, 58°C 15 s, 72°C 30 s, 45 cycles. RT- qPCR expression levels were normalized to the a-tubulin level for each tissue, using primers designed on the sequence of Oncidium Gower Ramsey according to Hou and Yang (2009) (Table 1). PCR efficiency of each run was calculated using the LinRegPCR program http:// LinRegPCR.nl (Pfaffl 2001). Expression data were analyzed with the Bonferroni test of the R software (R Development Core Team 2009). Results shown are mean ± standard deviation of two replicas of two inde- pendent biological samples, calibrated to the expression in leaf tissue.
Results
Cloning of Cyrtochilum loxense SERK (ClSERK)
Degenerated primers were designed on conserved regions of ZIP domain (S3) and kinase domain (S1) of carrot and Arabidopsis SERK genes (Baudino et al. 2001). A first PCR amplification, followed by a touch-up PCR with the same couple of primers (see above), gave a single band of 1,200 bp similarly to the predicted amplicon size for maize, rice, and coconut SERK genes. Sequence analysis of this amplicon showed a high similarity to SERK1 of Cocos nucifera and Oryza sativa (89% in both cases). This indi- cates that the gene producing this band is a putative member of the SERK family and was named ‘‘ClSERK’’.
To obtain the full-length cDNA sequence, 50 and 30
RACE PCRs were performed. For all amplification reac- tions, the cDNA obtained from embryogenic calluses was used as template. The entire ClSERK gene was successfully amplified using the same template and primers designed on
the sequences encoding start and stop codon regions (Table 1). The ClSERK cDNA sequence (EMBL accession number FN994192) confirmed the presence of an open reading frame (ORF) of 1,860 bp.
Sequence analysis
Compared to other characterized SERK genes, ClSERK showed the highest nucleotide identity to CnSERK (80%; GenBank accession no. AY791293.2), OsSERK1 (77%; GenBank accession no. AY652735.1), Hordeum vulgare HvSERK3 (77%; GenBank accession no. EF216861.1), Glycine max GmSERK (77%; GenBank accession no. FJ014794.1) Theobroma cacao TcSERK (77%; GenBank accession no. AY570507.1), and Cyclamen persicum CpSERK (77%; GenBank accession no. EF672247.2).
The deduced amino acid sequence consists of 619 amino acids, with a calculated molecular mass of 68.504 kD and a predicted pI of 6.06.
The protein belongs to the tyrosine-specific kinase subfamily (Smart00219 E-value: 5,14e-43) of the protein kinase superfamily (Cl09925 E-value: 5,16e-41) (Marchler- Bauer et al. 2009). Amino acid sequence identity between ClSERK protein and counterparts from other species ran- ged from 78 to 87%. The highest similarity was with CnSERK (Q5S1N9) and OsSERK1 (Q6Z4U4) (87% in both cases). As shown in Fig. 1, amino acid conservation spans the entire sequence except for the N-terminal signal peptide, serine proline-rich domain (SPP), and C-terminal domain, strongly indicating that ClSERK is a member of the SERK gene family.
The signal peptide sequence has a possible cleavage site between positions 30 and 31 (Fig. 1), as shown by Scan- Prosite analysis.
ClSERK is a putative membrane type I protein with a transmembrane region, which involves amino acids 249–265, and a cytoplasmic tail spanning from aa 266 to 619.
The analysis of this protein shows that it belongs to the protein kinase superfamily as it contains all domains found in SERK proteins of other species, such as a signal peptide (SP) domain (33 aa), a leucine zipper (ZIP) domain (45 aa), five LRR domains (120 aa for all five LRRs), an SPP motif (38 aa), which is the hallmark of SERK proteins, a trans- membrane domain (TM, 42 aa), and finally a kinase domain (341 aa) (Fig. 2).
ORF of ClSERK and relation to other SERKs
The relationships between ClSERK and other plant SERK genes was studied by phylogenetic reconstruction based on the alignment of 31 amino acid sequences: 28 of angio- sperm species (15 dicots and 13 monocots), two of
gymnosperm species (2 conifers), and one moss species. The use of Physcomitrella patens, a bryophyte from which angiosperms diverged about 450 million years ago (Ren- sing et al. 2008), allowed the reconstruction of a more complete evolutionary tree.
The phylogenetic tree (Fig. 3) represents three clades: one clade named Dicot SERK1/SERK2, a group of all dicot proteins; the second clade formed by the two gymnosperm and one moss species; and the third clade, named Monocot SERK clade, including all monocot SERK proteins used for the analysis that are either SERK1, 2, or 3 proteins. The ClSERK protein lies close to C. nucifera inside the Monocot SERK clade, while the other monocot proteins form two sub-clades each containing SERK1, 2, or 3 proteins. Expression analysis We analyzed the expression of the ClSERK in embryogenic calluses after 20, 32, and 40 days of SE induction. The results (Figs. 4, 5) show that ClSERK is expressed in all embryogenic calluses, but its expression is significantly higher (P <0.05) 20 days after the induction when cal- luses are characterized by the presence of small globular embryos. Other studies have reported a higher expression of SERK1 during the initial phase of somatic embryogen- esis (De Oliveira Santos et al. 2005). On the contrary, ClSERK is less expressed in calluses with protocorm-like bodies, which are the first orchid structures that are formed after germination (of both zygotic and somatic embryos). Discussion Considering the rapid loss of orchid diversity in tropical countries and the possibility of using in vitro culture techniques for long-term germplasm conservation and transformation experiments, a better understanding of molecular aspects could offer the possibility of increasing the number of explants responsive to SE, particularly for those orchid species with seed shortage, providing enor- mous benefits to orchid conservation. Since the first SERK gene was isolated and characterized, many SERK genes have been isolated from several plant species. Before 2001, five SERK genes had been identified in A. thaliana (Hecht et al. 2001), but recently a total of six SERK genes and three SERK-like genes were identified in the model legume M. truncatula. The information generated for the latter species was used to identify SERK genes in the recently sequenced soybean (Glycine max) genome, leading to the identification of 14 SERK-like genomic sequences (Nolan et al. 2011). Furthermore, in the case of MtSERK3, seven splicing variants were observed and predicted to form five
Fig. 1 Alignment of predicted amino acid sequences of SERK family protein kinases. Alignment was performed using ClustalX 2.0.11. Amino acid residues identical in all the listed proteins are highlighted
in black and similar ones are highlighted in gray. Percentages indicate amino acid identity among considered ClSERK
Fig. 2 Structure of ClSERK gene. Schematic drawing of the typical domains of an SERK gene (Bar 100 bp). The positions of different primers used are marked by arrows
Fig. 3 Phylogenetic tree showing the relationships between the deduced amino acid sequence of Cyrtochilum loxense SERK com- pared to SERK genes of other species. The multiple alignment of ClSERK gene (FN994192), two Arabidopsis thaliana SERK genes (AtSERK1-Q94AG2 and AtSERK2-Q9XIC7), two Arabidopsis lyrata genes (Al-D7KYY7, putative uncharacterized protein and Al-D7KJF7, predicted protein), three Zea mays SERK genes (Zm-B7ZZU3, putative uncharacterized protein; ZmSERK2-Q94IJ5 and ZmSERK3/BAK1-Q94IJ31), three Oryza sativa genes (OsSERK1-Q6Z4U41; OsBISERK-Q6S7F1; Os-B8BB68, putative uncharacterized protein), two Populus trichocarpa genes (Pt-B9IQM9 and Pt-B9MW41, predicted protein), two Sorghum bicolor genes (Sb-C5XVP5- and Sb-C5Y9S6, putative uncharacterized proteins), two Solanum genes (StSERK-A3R789 and SpSERK1-A6N8J2), one Hordeum vulgare gene (HvSERK3/BAK1-A2TLT1), one Cocos
different proteins (Nolan et al. 2011). Among monocots, the highest number of SERK genes has been found in Zea mays and Triticum aestivum, with three SERK genes identified for both species (Baudino et al. 2001; Singla et al. 2008). Although the role of SERK genes in somatic embryogenesis has been defined, molecular aspects of orchid somatic embryogenesis have not been studied and SERK genes not isolated. The cloning of the first orchid full-length SERK gene of the Ecuadorian orchid Cyrto- chilum loxense aimed at overcoming this gap.
The identity of ClSERK was confirmed by the fact that the predicted protein included all domains observed in
nucifera gene (CnSERK-Q5S1N9), one Citrus sinensis (CsSERK- C3V9W0), one Glycine. max gene (GmSERK-C6ZGA8), one Vitis vinifera gene (Vv-A5BIY4-Putative uncharacterized protein), one Carica papaya gene (Cp-BRSERK- A7L4A8), one Dimocarpus longan gene (DlSERK-B5TTV0), one Medicago truncatula gene (MtSERK1-Q8GRK2), one Citrus unshui gene (CuSERK1-Q6BE26), one Solanum hybrid gene (ShSERK1-C9E3K8), one Tritucum aestivum gene (TaSERK3/BAK1-B2ZPK4), two conifer genes (Arau- caria angustifolia Aa-ARAU-SERK1-D1MEH6 and Pinus massoni- ana PmSERK1-D5FY57), and one moss gene (Physcomitrella patens Pp-MOSS-A9SMW5, predicted protein) was performed by ClustalX 2.0.11 software and the phylogenetic tree was constructed by the neighbor-joining method and evaluated by 1000 bootstrap analysis (PHYLIP version 3.69) SERK proteins of other species. These domains consist of a signal peptide, a leucine zipper domain, which in A. tha- liana has been proven to be involved in the oligomerization of AtSERK1 proteins (Shah et al. 2001a), and five extra- cellular LRR domains that in general are involved in pro- tein–protein interactions (Kobe and Deisenhofer 1994) and required for the correct targeting of the protein to the plasma membrane (Shah et al. 2001b).
Another motif is SPP, which is the distinctive domain of all SERK proteins and is absent in other LRR-RLKs. This motif was suggested to act as a ‘‘hinge’’ to provide flexi- bility to the extracellular part of the protein (Hecht et al.
Fig. 4 Embryogenic calluses used for SERK1 expression analysis were quantified. a Callus at the initial phase of induction with some globular embryos (20 days after the induction). b Callus with initial
protocorm (black arrows) (30 days after induction). c Callus with developed protocorms (black arrows) (40 days after induction)
Fig. 5 Relative expression of ClSERK gene as determined by reverse transcription-qPCR analysis. Results shown are mean ± standard deviation of two independent samples calibrated to expression in leaf tissue. The morphology of embryogenic calluses used for the analysis of expression is shown in Fig. 4
2001). Other identified features are a single transmembrane domain, which separates the extracellular domain from the intracellular region, a kinase domain, and a C-terminal region (Fig. 2).
The kinase domain contains a Ser/Thr site (between residues 430–442) and a putative protein kinase ATP- binding region signature (between residues 313 and 335), which are characteristic sites of RLK signal transduction proteins (Stone and Walker 1995). The ClSERK deduced protein sequence shows the highest similarity to CnSERK and OsSERK1, while differences were found in the C-terminal domain, where ClSERK has only 37 amino acids, the signal peptide, and the SPP domain.
The phylogenetic analysis based on SERK protein sequences is consistent with previous studies that place monocots in one branch and dicots in a second branch with conifers and mosses (De Oliveira Santos et al. 2005). Among the monocots, ClSERK diverged early from the compared orthologs, similarly to CnSERK.
The members of the SERK gene family of O. sativa appear in the same branch, indicating that duplications occurred after speciation, consistently with ancestral whole-genome dupli- cation reported for rice (Guyot and Keller 2004). A similar situation can be observed in the case of Populus trichocarpa which underwent a genome duplication (Tuskan et al. 2006) and in the case of A. thaliana and A. lyrata.
On the other hand, for SERK belonging to Z. mays and Sorghum bicolor, two groups are present regardless of the species, suggesting that at least one duplication event happened more than 12 millions years ago, when the two species diverged (Wei et al. 2007).
The role of SERK genes was associated with somatic and zygotic embryogenesis. Transcription of DcSERK, the first identified SERK gene, was observed during the formation of proembryogenic masses up to the 100-celled globular stage (Schmidt et al. 1997). The expression of the orthologous At- SERK1 was also detected at early stages of both somatic and zygotic embryo development (Hecht et al. 2001). Most of the
other SERK genes were also expressed during somatic embryogenesis. Moreover, in SERK-silenced transgenic lines of Lactuca sativa, the ability to form somatic embryos was reduced (Santos et al. 2009). As a whole, SERK gene expression is correlated with embryogenesis in many plant species being strongly expressed during the early phases of somatic embryogenesis induction and in developing embryos (Maillot et al. 2010). Besides embryogenesis, in M. truncatula and Helianthus annuus, SERK gene expression is stimulated by treatments inducing organogenesis, suggesting a more general role of SERK genes during morphogenesis (Maillot et al. 2010). Expression of four Rosa hybrida SERK genes in both embryogenic and non-embryogenic tissues also indicates a more general role of SERK genes (Zakizadeh et al. 2010). In fact, SERK genes have been found to be involved in other processes such as male sterility (AtSERK1/2, Albrecht et al. 2005), apomixis (Albertini et al. 2005), brassinosteroid (BR) signaling, and plant defense (Li et al. 2002; Song et al. 2008; Hu et al. 2005; Kemmerling et al. 2007). As for ClSERK, we have found that this gene is highly expressed in calluses grown for 20 days on the induction medium containing 2,4-D and TDZ. It is worth noting that at this time, we observed the appearance of the morphological features of calluses with embryogenic potential generated from protocorms (Fig. 4). At 32 and 40 days, when embryos became well visible on calluses, the expression of ClSERK gene decreased. These results agree with the observation made in the case of coconut embryogenic calluses, where SERK gene shows an expression peak after 30 days of culture on 2,4-D-containing medium, when the first morphological evidence of embryogenic callus formation occurs (Perez-Nu n ez et al. 2009). On the other hand, the expression in leaf tissues is far lower than that of embryo-forming calluses.
Besides these observations, results obtained with Ara- bidopsis transgenic plants showed that up-regulation of AtSERK enhanced the rate of somatic embryogenesis (Hecht et al. 2001) suggesting a possible strategy for improving the regeneration potential of Ecuadorian orchid plants and contributing to their ex situ conservation. To prove this concept, we are currently analyzing transformed C. maxima carrying a heterologous OsSERK cDNA driven by a 35S promoter with respect to their regeneration potential and range of responsive explants.
Acknowledgments This work was partially supported by a fel- lowship of the SENESCYT awarded to A. Cueva. We are grateful to Paolo Longoni for his help with qPCR and Tara Ball for her help with the English language.
References
Albertini E, Marconi G, Reale L, Barcaccia G, Proceddu A, Ferranti F, Falcinelli M (2005) SERK and APOSTART. Candidate genes
for apomixis in Poa pratensis. Plant Physiol 138:2185–2199. doi:10.1104/pp.105.062059
Albrecht C, Russinova E, Hecht V, Baaijens E, Vries SD (2005) The Arabidopsis thaliana SOMATIC EMBRYOGENESIS RECEP- TOR-LIKE KINASES1 and 2 control male sporogenesis. Plant Cell 17:3337–3349. doi:10.1105/tpc.105.036814.as
Albrecht C, Russinova E, Kemmerling B, Kwaaitaal M, de Vries SC (2008) Arabidopsis SOMATIC EMBRYOGENESIS RECEP- TOR KINASE proteins serve brassinosteroid-dependent and- independent signaling pathways. Plant Physiol 148:611–619. doi:10.1104/pp.108.123216
Altschul S, Madden T, Schaffer A, Zhang J, Zhang Z, Miller W, Lipman D (1997) Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res 25:3389–3402. doi:10.1093/nar/25.17.3389
Baudino S, Hansen S, Brettshneider R, Hecht VFG, Dresselhaus T, Lors H, Dumas C, Rogowsky PM (2001) Molecular characterization of two novel maize LRR receptor-like kinase, which belong to the SERK gene family. Planta 213:1–10. doi:10.1007/s004250000471
Chen JT, Chang WC (2001) Effects of auxins and cytokinins on direct somatic embryogenesis from leaf explants of Oncidium ‘Gower Ramsey’. Plant Growth Regul 34:229–232. doi:10.1023/A:1013304 101647
Chen J, Chang W (2002) Effects of tissue culture conditions and explant characteristics on direct somatic embryogenesis in Oncidium. Plant Cell Tiss Organ Cult 69:41–44. doi:10.1023/ A:1015004912408
Chen JT, Chang WC (2003) 1-aminocyclopropane-1-carboxylic acid enhanced direct somatic embryogenesis from Oncidium leaf cultures. Biol Plant 46:455–458. doi:10.1023/A:1024307025893
Chen J, Chang W (2006) Efficient and repetitive production of leaf- derived somatic embryos of Oncidium. Biol Plant 50:107–110. doi:10.1007/s10535-005-0081-y
Chugh A, Khurana P (2002) Gene expression during somatic embryogenesis: recent advances. Curr Sci 83:715–730. doi: 10.1007/s11103-006-9013-2
Chung HH, Chen JT, Chang WC (2007) Plant regeneration through direct somatic embryogenesis from leaf explants of Dendrobium. Biol Plant 51:346–350. doi:10.1007/s10535-007-0069-x
Condemarın-Montealegre C, Chico-Ruiz J, Vargas-Arteaga C (2007) Efecto del acido indol butırico (IBA) y 6-Bencilaminopurina (BAP) en el desarrollo in vitro de yemas axilares de Encyclia Microtos (Rchb.f.) Hoehne (Orchidaceae). Lankesteriana 7:247–254
Cueva A, Gonzalez Y (2009) In vitro germination and somatic embryogenesis induction in Cyrtochilum loxense, an endemic, vulnerable orchid from Ecuador. In: Pridgeon AM, Suarez JP (eds) Proceedings of the second scientific conference on Andean orchids. Universidad Tecnica Particular de Loja, Loja, Ecuador, pp 56–62
De Oliveira Santos M, Romanoa E, Clemente K, Penha M, Barreto Andrade B, Lima F (2005) Characterisation of the cacao Somatic Embryogenesis Receptor-like Kinase (SERK) gene expressed during somatic embryogenesis. Plant Sci 168:723–729. doi: 10.1016/j.plantsci.2004.10.004
Endara L (2000) (Orchidaceae) In: Valencia R, Pitman N, Leo n- Yanez S, Jørgensen PM (Eds.). Libro rojo de las plantas endemicas del Ecuador Herbario QCA, Pontificia Universidad Cato lica del Ecuador, Quito-Ecuador, pp 257–372
Fang-Yi J, Do Y, Liauh Y, Chung J, Huang P (2006) Enhancement of growth and regeneration efficiency from embryogenic callus cultures of Oncidium Gower Ramsey by adjusting carbohydrate sources. Plant Sci 170:1133–1140. doi:10.1016/j.plantsci.2006. 01.016
Gaj M (2004) Factors influencing somatic embryogenesis induction
and plant regeneration with particular reference to Arabidopsis thaliana (L.) Heynh. Plant Growth Regul 43:27–47. doi: 10.1023/B:GROW.0000038275.29262.fb
Guyot R, Keller B (2004) Ancestral genome duplication in rice. Genome 47:610–614. doi:10.1139/g04-016
He K, Gou X, Yuan T, Lin H, Asami T, Yoshida S, Russell SD, Li J (2007) BAK1 and BKK1 regulate brassinosteroid-dependent growth and brassinosteroid-independent cell-death pathways. Curr Biol 17:1109–1115. doi:10.1016/j.cub.2007.05.036
Hecht V, Vielle-Calzada JP, Hartog MV, Schmidt EDL, Boutilier K, Grossniklaus U, de Vries SC (2001) The Arabidopsis somatic embryogenesis receptor kinase 1 gene is expressed in developing ovules and embryos and enhances embryogenic competence in culture. Plant Physiol 127:803–816. doi:10.1104/pp.010324
Hofmann K, Bucher P, Falquet L, Bairoch A (1999) The PROSITE database: its status in 1999. Nucleic Acids Res 27:215–219. doi: 10.1093/nar/27.1.215
Hong PI, Chan JT, Chang WC (2008) Promotion of direct somatic embryogenesis of Oncidium by adjusting carbon sources. Biol Plant 52:597–600. doi:10.1007/s10535-008-0119-z
Hou C, Yang C (2009) Functional analysis of FT and TFL1 orthologs from orchid (Oncidium Gower Ramsey) that regulate the vegeta- tive to reproductive transition. Plant Cell Physiol 50:1544–1557. doi:10.1093/pcp/pcp099
Hu H, Xiong L, Yang Y (2005) Rice SERK1 gene positively regulates somatic embryogenesis of cultured cells and host defense response against fungal infection. Planta 222:107–117. doi: 10.1007/s00425-005-1534-4
Huan LVT, Takamura T, Tanaka M (2004) Callus formation and plant regeneration from callus through somatic embryo struc- tures in Cymbidium orchid. Plant Sci 166:1443–1449. doi: 10.1016/j.plantsci.2004.01.023
Ikeda M, Umehara M, Kamada H (2006) Embryogenesis-related genes; its expression and roles during somatic and zygotic embryogenesis in carrot and Arabidopsis. Plant Biotechnol 23:153–161. doi:10.5511/plantbiotechnology.23.153
Ishii Y, Takamura T, Goi M, Tanaka M (1998) Callus induction and somatic embryogenesis of Phalaenopsis. Plant Cell Rep 17:446–450. doi:10.1007/s002990050423
Ito Y, Kazuhiko T, Nori K (2005) Expression of SERK family receptor-like protein kinase genes in rice. Biochim Biophys Acta 1730:253–258. doi:10.1016/j.bbaexp.2005.06.007
Jannick D, Nielsen H, von Heijne G, Brunak S (2004) Improved prediction of signal peptides: SignalP 3.0. J Mol Biol 340:783–795. doi:10.1016/j.jmb.2004.05.028
Kemmerling B, Schwedt A, Rodriguez P, Mazzotta S, Frank M, Abu Qamar S, Mengiste T, Betsuyaku S, Parker J, Mussig C, Thomma B, Albrecht C, de Vries S, Hirt H, Nurnberger T (2007) The BRI1-Associated Kinase 1, BAK1, has a brassinolide- independent role in plant cell-death control. Curr Biol 17:1116– 1122. doi:10.1016/j.cub.2007.05.046
Kobe B, Deisenhofer J (1994) The leucine-rich repeat: a versatile binding motif. Trends Biochem Sci 19:415–421. doi:10.1016/0968-0004 (94)90090-6 (Review)
Larkin A, Blackshields G, Brown N, Chenna R, McGettigan A, McWilliam H, Valentin F, Wallace I, Wilm A, Lopez R, Thompson J, Gibson T, Higgins D (2007) Clustal W and Clustal X version 2.0. Bioinformatics 23:2947–2948. doi:10.1093/bioinformatics/ btm404
Li J, Wen J, Lease K (2002) BAK1, an Arabidopsis LRR Receptor-like Protein Kinase, Interacts with BRI1 and modulates brassinosteroid signaling. Cell 110:213–222. doi:10.1016/S0092-8674(02) 00812-7
Maillot P, Walter B, Schellenbaum P (2010) Somatic Embryogenesis Receptor-like Kinases are related to embryogenesis and other
developmental and defence pathways. In: Kumar A (ed) Plant genetic transformation and molecular markers. Pointer Publish- ers, Jaipur, India, pp 149–167
Marchler-Bauer A, Anderson J, Chitsaz F, Derbyshire M, DeWeese- Scott C, Fong J, Geer L, Geer R, Gonzales N, Gwadz M, He S, Hurwitz D, Jackson D, Ke Z, Lanczycki C, Liebert C, Liu C, Lu F, Lu S, Marchler G, Mullokandov M, Song J, Tasneem A, Thanki N, Yamashita R, Zhang D, Zhang N, Bryant S (2009) CDD: specific functional annotation with the Conserved Domain Database. Nucleic Acids Res 37:205–210. doi:10.1093/nar/ gkn845
Nakai K, Kanehisa M (1992) A knowledge base for predicting protein localization sites in eukaryotic cells. Genomics 14:897–911. doi: 10.1016/S0888-7543(05)80111-9
Nolan K, Kurdyukov S, Rose R (2011) Characterisation of the legume SERK-NIK gene superfamily including splice variants: impli- cations for development and defence. Plant Biol 11:44–60. doi: 10.1186/1471-2229-11-44
Perez-Nu n ez MT, Souza R, Saenz L, Chan JL, Zuniga-Aguilar JJ, Oropeza C (2009) Detection of a SERK-like gene in coconut and analysis of its expression during the formation of embryogenic callus and somatic embryos. Plant Cell Rep 28:11–19. doi: 10.1007/s00299-008-0616-8
Pfaffl MW (2001) A new mathematical model for relative quantifi- cation in real-time RT-PCR. Nucleic Acids Res 29:2002–2007. doi:10.1093/nar/29.9.e45
R Development Core Team (2009) R: A language and environment for statistical computing. R Foundation for Statistical Comput- ing, Vienna
Reinert J (1958) Untersuchungen u ber die Morphogenese an Gew- ebekulturen. Ber Dtsch Bot Ges 71:15. doi:10.1007/BF01881795
Rensing SA, Lang D, Zimmer AD, Terry A, Salamov A, Shapiro H, Nishiyama T, Perroud PF, Lindquist EA, Kamisugi Y et al (2008) The Physcomitrella genome reveals evolutionary insights into the conquest of land by plants. Science 319:64–69. doi: 10.1126/science.1150646
Saitou N, Nei M (1987) The neighbor-joining method: a new method for reconstruction phylogenetic trees. Mol Biol Evol 4:406–425
Santos MO, Romano E, Vieira LS, Baldoni AB, Aragao FJL (2009) Suppression of SERK gene expression affects fungus tolerance and somatic embryogenesis in transgenic lettuce. Plant Biol 11:83–89. doi:10.1111/j.1438-8677.2008.00103.x
Schmidt ED, Guzzo F, Toonen MA, de Vries SC (1997) A leucine- rich repeat containing receptor-like kinase marks somatic plant cells competent to form embryos. Development 124:2049–2062
Shah K, Gadella TW, van Erp H, Hecht V, de Vries SC (2001a) Subcellular localization and oligomerization of the Arabidopsis thaliana somatic embryogenesis receptor kinase 1 protein. J Mol Biol 309:641–655. doi:10.1006/jmbi.2001.4706
Shah K, Vervoort J, de Vries S (2001b) Role of threonines in the Arabidopsis thaliana somatic embryogenesis receptor 1 activa- tion loop in phosphorylation. J Bilo Chem 276:41263–41269. doi:10.1074/jbc.M102381200
Shiu SH, Bleecker AB (2003) Expansion of the receptor-like kinase/ Pelle gene family and receptor-like proteins in Arabidopsis. Plant Physiol 132:530–543. doi:10.1104/pp.103.021964
Shiu SH, Karlowski WN, Pan R, Tzeng YH, Mayer KFX, Li WH (2004) Comparative analysis of the receptor-like kinase family in Arabidopsis and rice. Plant Cell 16:1220–1234. doi:10.1105/ tpc.020834
Shu-Hua L, Kuoh C, Chen Y, Chen H, Chen W (2005) Osmotic sucrose enhancement of single-cell embryogenesis and transfor- mation efficiency in Oncidium. Plant Cell Tiss Organ Cult 81:183–192. doi:10.1007/s11240-004-4955-z
Somleva MN, Schmidt EDL, de Vries SC (2000) Embryogenic cells in Dactylis glomerata L. (Poaceae) explants identified by cell tracking and by SERK expression. Plant Cell Rep 19:718–726. doi:10.1007/s002999900169
Song D, Li G, Song F, Zheng Z (2008) Molecular characterization and expression analysis of OsBISERK1, a gene encoding a leucine- rich repeat receptor-like kinase, during disease resistance responses in rice. Mol Biol Rep 35:275–283. doi:10.1007/s11033-007- 9080-8
Steward FC, Mapes MO, Mears K (1958) Growth and organized development of culture cells. II. Organization in cultures grown from freely suspended cells. Am J Bot 45:705–708
Stone JM, Walker J (1995) Plant protein kinase families and signal transduction. Plant Physiol 108:451–457. doi:10.1104/pp.108. 2.451
Su YJ, Chen J, Chang W (2006) Efficient and repetitive production of leaf-derived somatic embryos of Oncidium. Biol Plant 50:107– 110. doi:10.1007/s10535-005-0081-y
Tokuhara K, Mii M (2001) Induction of embryogenic callus and cell suspension culture from shoot tips excised from flower stalk buds of Phalaenopsis (Orchidaceae). In Vitro Cell Dev Biol 37:457–461. doi:10.1007/s11627-001-0080-4
Tuskan GA, Difazio S, Jansson S, Bohlmann J, Grigoriev I, Hellsten U, Putnam N, Ralph S, Rombauts S, Salamov A, Schein J, Sterck L, Aerts A, Bhalerao RR, Bhalerao RP et al (2006) The genome of black cottonwood, Populus trichocarpa (Torr. & Gray). Science 313:1596–1604. doi:10.1126/science.1128691
Walker JC (1994) Structure and function of the receptor-like protein kinases of higher plants. Plant Mol Biol 26:1599–1609. doi: 10.1007/BF00016492 (review)
Wei F, Coe E, Nelson W, Bharti AK, Engler F, Butler E, Kim H, Goicoechea JL, Chen M, Lee S, Fuks G, Sanchez-Villeda H, Schroeder S, Fang Z, McMullen M, Davis G, Bowers JE, Paterson AH, Schaeffer M, Gardiner J, Cone K, Messing J, Soderlund C, Wing RA (2007) Physical and genetic structure of the maize genome reflects its complex evolutionary history. PLoS Genet 3:1254–1266. doi:10.1371/journal.pgen.0030123
Zakizadeh H, Stummann BM, Lu tken H, Mu ller R (2010) Isolation and characterization of four Somatic Embryogenesis Receptor- like Kinase (RhSERK) genes from miniature potted rose (Rosa hybrida cv. Linda) Plant Cell. Tissue Organ Cult 101:331–338. doi:10.1007/s11240-010-9693-9
