at SciVerse ScienceDirect

Fish & Shellfish Immunology 31 (2011) 1297e1302

Contents lists available

Fish & Shellfish Immunology

journal homepage: www.elsevier .com/locate / fs i

Short communication

Genomic organization and tissue-specific expression of hepcidin in the pacificmutton hamlet, Alphestes immaculatus (Breder, 1936)

Jorge Masso-Silva a, Gill Diamond b, Maria Macias-Rodriguez a, Felipe Ascencio a,*

aUnidad de Patologia Marina, Centro de Investigaciones Biologicas del Noroeste (CIBNOR), Mar Bermejo 195, Col, Playa Palo de Santa Rita, La Paz, BCS 23090, MexicobDepartment of Oral Biology, UMDNJ-New Jersey Dental School, NJ, USA

a r t i c l e i n f o

Article history:Received 7 July 2011Received in revised form12 September 2011Accepted 5 October 2011Available online 19 October 2011

Keywords:Alphestes immaculatusHepcidinAntimicrobial peptidesTranscription factorsGene expression

Abbreviations: AP-1, activator protein 1; c-Rel, pCCAAT-enhancer-binding proteins a; CEBPb, CCAAT-eGATA-1, GATA binding protein 1; HAMP1, hepcidine anhepatocyte nuclear factor 3; IL-6 RE-BP, interleukinprotein; iPCR, inverse PCR; LPS, lipopolysaccharide;light-chain-enhancer of activated B cells; NMR, pronance spectroscopy; RACE, rapid amplification ofprotein 1; USF2, upstream stimulatory factor 2.* Corresponding author. Tel.: þ52 612 1238495; fax

E-mail address: ascencio@cibnor.mx (F. Ascencio).

1050-4648/$ e see front matter � 2011 Elsevier Ltd.doi:10.1016/j.fsi.2011.10.007

a b s t r a c t

Hepcidin is a cysteine-rich peptide involved in iron metabolism, inflammatory response and as anti-microbial peptide. Despite the fact that hepcidins have been identified in several fish species, only fewhave been completely characterized. This study, described the identification and complete molecularcharacterization of the hepcidin antimicrobial peptide 1 (HAMP1) gene of Alphestes immaculatus.Moreover, its specific expression level at both basal and lipopolysaccharide (LPS)-induced conditions indifferent tissues was also determined by real-time PCR. Results showed that the HAMP1gene consists ofthree exons and two introns encoding a preprohepcidin composed of 90 aa (24 aa for signal peptide, 40aa for prodomain and 26 aa for mature peptide). The promoter region analysis revealed a TATA boxsequence and several putative transcription factor binding sites. A comparative analysis showed CEBPa,CEBPb, NF-kB, HNF3, GATA-1 and c-Rel as the most common found in fishes. The mature peptidepossesses a pI of 8.34, which is the average among fish hepcidin. In addition, the structural modelingshowed a hairpin structure with four putative disulfide bonds. A phylogenetic analysis revealed that thishepcidin gene is a HAMP1 class, and is clustered into the same group with the Serranid fish Epinephelusmoara and the Antarctic fish Lycodichthys dearborni. Finally, the relative expression levels showed highbasal values in liver and muscle, whereas in LPS-induced fish the relative expression tendency changed,with the highest values in spleen and head kidney tissues. This study describes the completely char-acterized HAMP1 gene of A. immaculatus and their patterns of expression level at different conditionsand in different tissues, showing by first time muscle hepcidin expression could be relevant in theimmune response in fish.

� 2011 Elsevier Ltd. All rights reserved.

1. Introduction

Hepcidin is a cysteine-rich peptide, first discovered in humanswith antimicrobial activity [1,2]. Generally, hepcidin containsamature peptidewith eight cysteines forming fourdisulfidebonds toobtain its amphipatic conformationwith cationic residues which actagainst bacteria [3], fungi [4], viruses [5] and tumor cells [6]. Besides,hepcidin is consideredanacutephaseprotein, infishesandmammals

roto-oncogene c-Rel; CEBPa,nhancer-binding proteins b;timicrobial peptide 1; HNF3,6 response element bindingNF-kB, nuclear factor kappa-tein nuclear magnetic reso-cDNA ends; Sp1, specificity

: þ52 612 1238525.

All rights reserved.

[7,8]. Additionally, in humans there is clear evidence that hepcidin isinvolved in iron metabolism by ferroportin degradation [9].

Since its discovery in humans, hepcidin has been identified inseveral other vertebrates, including fishes. Hybrid striped bass(Morone chrysops � Micrococcus saxatilis) was the first fish wherehepcidin was identified, and its expression was induced by Micro-coccus luteus and Escherichia coli challenges [8]. Later, the solutionstructure was elucidated by NMR, showing high similarity to humanhepcidin [3]. Since then, hepcidin was identified in several fishspecies [8,10,11]. However, despite the multiple roles of hepcidinpreviouslymentioned, infishes, themajor research focushasbeenonantimicrobial activity. Actually, hepcidin is one of the most studiedantimicrobial peptides in fishes due to its physiological relevance,even though several other antimicrobial peptides like, pardaxin [12],piscidin or pleurocidin [13], histone-derived peptides [14], cath-elecidin [15] among others, have also been identified in fishes.

While humans [1] and mice [16] possess one and two genecopies, respectively, fishes contain up to seven hepcidin gene copies

Table 1List of primers used in the present study.

Primer name Primer sequence 50e30 Annealingtemperature(�C)

HepFl ATGAAGVCATTCAGYRTTGC 56HepRl CYTSMTGWKCMGCARCTGGAiHepRACE 3 TATTTGCATTCTGGAGAGCTCTGCCGTC 68AiHepRACE 5 GAGAAAGAGGTCAAGAAAAGGTCATTTCTTGGGGAihepRACE5nest AGAACTTGCAGCAGAAGCCGCAGC 68AiHepPCRi5 TTGCTCGCTGCCTCCTCCAGCTCTTGCAiHepPCRi3 ATGCCAGATCACGTCAGGCAGAAGCG 68AiHepPCRi5nest TGAATGGGACGGCAGAGCTCTCC 68AiHepPCRi3nest AACTGCTGCAGAGGCAACAAAGGCTGAiHepq F TATGAAGGCATTCAGTGTTGC 60AiHepq R GGAGTGTCATTGCTCGCTGAil8sq F CGAAAGCATTTGCCAAGAAT 60Ail8sq R AGTTGGCACCGTTTATGGTC

J. Masso-Silva et al. / Fish & Shellfish Immunology 31 (2011) 1297e13021298

[17]. In addition, the hepcidin expression profiles frequentlyshowed liver as the tissue with the highest expression [10,18].Related to this, lipopolysaccharides (LPS) have shown to be capableto induce hepcidin expression in some fishes such as Pseudosciaenacrocea [19], Paralichthys olivaceus [20,21], and Oreochromis mos-sambicus [18]. However, in tilapia two of three hepcidin isoformswere not up-regulated by LPS injection [18].

Considering the bare knowledge about hepcidin regulation infishes, the complete sequencing of hepcidin (including thepromoter region) will allow a better understanding of its geneticregulation and clarify the pathways where hepcidin could beinvolved in iron metabolism and as antimicrobial peptide. Here, wepresent and analyze both genomic and cDNA sequences of hepcidin(including the deduced amino acid sequence) in Alphestes immac-ulatus and evaluate its basal and LPS-induced relative expression inseveral tissues. In addition, we compared the hepcidin sequence ofthe A. immaculatus against other fish hepcidin sequences.

2. Materials and methods

2.1. Fish maintenance

Four apparently healthy Pacific mutton hamlet fish (25 � 2 g)were captured in La Paz Bay, Baja California Sur, Mexico. Theorganisms were acclimatized for 15 days at 27 � 1.5 �C, salinity of36 � 1 ppm, dissolved oxygen of 5.3e6.3% and fed with fresh fishonce per day.

2.2. Bioassays and RNA extraction

Two fish were challenged by intraperitoneal injectionwith 1 mg(200 mL) of E. coli LPS (Sigma�) for gene characterization and toevaluate LPS-induced relative expression. The other two fish wereinjected intraperitoneally with 200 mL of sterile phosphate-buffered saline solution (pH 7.4) to evaluate basal hepcidin rela-tive expression. Nine tissues were sampled 4 h after the injection:liver, spleen, head kidney, anterior intestine, skin, gills, eyes, brainand muscle. Tissues were homogenized by pulverization withliquid nitrogen and total RNA was extracted with FastRNA� ProGreen Kit (BM Biomedicals) and stored at �80 �C until used.

2.3. Determination of full-length genomic and cDNA

Liver RNA treated with DNase I (Invitrogen�) was used fora reverse transcription reaction with SuperScript� III reverse

Fig. 1. Organization of A. immaculatus gene. The exons are represented by boxes: signal peUntranslated region (UTR30 and UTR50) are showed in white boxes. In addition, the upstreamfactor binding sites (NF-kB, C/EBPa, GATA -1, AP-1, c-Rel, USF2, C/EBPb, Sp1 and IL-6 RE-Bsequence.

transcriptase (Invitrogen�). In order to obtain a partial sequence,a standard PCR was performed with a set of degenerate primersbased on the consensus regions of the signal peptide in a multiplealignment of fish hepcidins (HepF1 and HepR1, see Table 1). Fromthe obtained partial sequence a RACEwas performedwith SMART�RACE cDNA Amplification Kit (Clontech Laboratories, Inc.) using theAiHepRACE3, AiHepRACE5 and AihepRACE5nest primers (Table 1).

To obtain the complete genomic sequence, genomic DNA wasextracted [22] and then two strategieswere performed: 1) to obtainintrons, the primers AiHepRACE3 and AiHepRACE5 were used, and2) to obtain the promoter region of the gene an iPCRwas carried outas previously described [23]. For this iPCR, genomic DNA wasdigested with endonucleases EcoRI, XbaI, MboI and BamHI. Then,the ligated DNAs (circularized) were used as templates for a nestedPCR, where a first PCR was performed with AiHepPCRi3 andAiHepPCRi5primers and the second one with AiHepPCRi3nest andAiHepPCRi5nest (Table 1).

Amplicons were cloned into the pGEM� T-easy vector system(PROMEGA�) and sequenced by MACROGEN Inc. Once thecomplete sequence was assembled, an upstream search for tran-scription factor binding sites was carried out using the TFsearch(http://www.cbrc.jp/research/db/TFSEARCH.html) and TESS(http://www.cbil.upenn.edu/cgi-bin/tess/tess) softwares. Addi-tionally, the predicted cleavage site of the signal peptide was ob-tained by Signal P 3.0 software (http://www.cbs.dtu.dk/services/SignalP) and the motif RX (K/R) R of the propeptide convertasewas found by MEGA 4.0.2 in the deduced amino acid sequence.

ptide in mottled box; prodomain in stripped boxes and mature peptide in black box.region of the genomic sequence contains the TATA box and the putative transcription

P) with the nucleotide number in brackets using as a reference the start of the cDNA

Fig. 2. Multiple alignment of fish preprohepcidins. The predicted site of cleavage of the signal peptide and mature peptide (processing site where the RX(K/R)R motif ends) aremarked with arrows. Conserved cysteines of the mature peptide are marked with asterisks.

J. Masso-Silva et al. / Fish & Shellfish Immunology 31 (2011) 1297e1302 1299

2.4. Structural modeling and determination of molecular weight,isoelectric point and charge

Once the complete sequence was assembled, the maturepeptide was submitted for modeling structure using the crystalstructure of striped bass hepcidin (PDB ID: 1S6W) as a template.The analysis was carried out by SWISS-MODEL software (SwissInstitute of Bioinformatics) and the resulting model was editedwith ViewerLite 5.0 (Accelrys Inc.).

Themolecular weight, isoelectric point and charge (estimated toa pH ¼ 7.0) of the mature peptide was calculated by the ProteinCalculator 3.3 software (http://www.scripps.edu/wcdputnam/protcalc.html).

2.5. Multiple hepcidin alignment and phylogenetic analysis

Deduced aminoacid sequences from 13 hepcidin gene sequenceswere used to construct a preprohepcidin multiple alignment byCLUSTALW using MEGA 4.0.2 software. Besides, a Neighbor-Joiningphylogenetic tree of 42preprohepcidin sequences withJoneseTayloreThornton matrix (JTT) model, pairwise deletion optionand10,000replicatesofbootstrapwasbuiltwithMEGA4.0.2. software.

Fig. 3. Hepcidin of A. immaculatus. a).- Hepcidin predicted ribbon model ofA. immaculatus using hybrid striped bass hepcidin as template. Disulfide bonds are inthin tubes and the preprohepcidin position (number of aminoacid) of every cysteine isindicated. b).- Secondary structure of hepcidin of A. immaculatus. Every cysteine is inblack circles with their respective sulfide bonds and the positive charged aminoacidare indicated with þ.

2.6. Tissue-specific expression analysis of hepcidin by real-time RT-PCR

cDNA of the nine sampled tissues was synthesized as describedabove. Then, both basal and LPS-induced relative expression levels

of every tissue were quantified by real-time PCR using the iQ�SYBR� Green Supermix (BIORAD�) system with AiHepqF andAiHepqR primers for hepcidin and Ai18sqF and Ai18sqR to amplifya region of a ribosomal 18s proteic subunit as housekeeping

J. Masso-Silva et al. / Fish & Shellfish Immunology 31 (2011) 1297e13021300

(Table 1). The tissue with the lowest relative expression level wasused as a calibrator or reference to calculate relative expression bythe 2�DDCt method. Every fold increment was related to thatparticular calibrator, showing different relative expressiontendencies between tissues for each condition.

3. Results and discussion

3.1. Structural analysis

The genomic sequence comprise 1106 bp and the mRNA 843 bp(with a coding region of 270 bp), resulting that HAMP1 gene of

Fig. 4. Phylogenetic tree of preprohepcidins of several fishes and mammals (outgroup). Numbar refers to percentage of divergence. Every specie name has the GenBank ID of the preprwhere the specie belongs is indicated in uppercase as follow: P ¼ Perciformes, PLE ¼ Pleuronorder in lowercase and italic style is indicated what kind of ecosystem the fish lives: maanadromous, catadromous and amphidromous. Fish hepcidin clusters are indicated with theirThe location of A. immaculatus is indicated with an asterisk.

A. immaculatus has three exons and two introns as the rest ofhepcidins. In addition, the promoter region analysis showed thetranscription promoter TATA box (�33 bp) and several putativetranscription factor binding sites (NF-kB, C/EBPa, GATA-1, AP-1, c-Rel, USF2, C/EBPb, Sp1 and IL-6 RE-BP) that could be involved inhepcidin regulation (Fig. 1). Comparing those transcription factorbinding sites against others found in fishes, resulted that the mostrelevant involved in hepcidin regulation could be CEBPb, CEBPa,GATA, HNF3, NF-kB and c-Rel [3,11,17,20,24e26]. In this context, inhuman, transcription factor families like C/EBP and NF-kB/Rel caninduce hepcidin expression by IL-6 induction in the type II acutephase response [27,28]. In future works, this transcription factor

bers on the branch indicate the percentage of 10,000 bootstrap samples and the scaleohepcidin sequence in brackets. At the right of the specie name the taxonomic Orderectiformes, SA ¼ Salmoniformes, CY ¼ Cypriniformes and SI ¼ Siluriformes. Next to therine, marine (A) (Antarctic), freshwater; and if they migrate among ecosystems like:respective number and the bottom cluster correspond to mammalian preprohepcidins.

Fig. 5. Relative expression levels of hepcidin from different tissues by real-time PCR inorganisms in basal (a) and LPS-induced (b) conditions.

J. Masso-Silva et al. / Fish & Shellfish Immunology 31 (2011) 1297e1302 1301

binding sites comparison could help to identify certain regulationmechanisms of hepcidin, clarifying the pathways where hepcidincould be involved in the immune response of fishes.

The multiple alignment of deduced amino acid sequencesshowed the sites of cleavage by the signal peptidase (SA-VP) and themotif RX(K/R)R of propeptide convertase typical of hepcidin (Fig. 2),resulting that A. immaculatus preprohepcidin is composed by 90 aa(24 aa for signal peptide, 40 aa for prodomain and 26 aa for maturepeptide, see Fig. 1). In addition, the mature peptide possesses theeight-cysteine consensus sequence for hepcidins, forming theputative four disulfide bonds as follow: Cys71-Cys88, Cys74-Cys87,Cys75-Cys84 and Cys77-Cys78 (Fig. 3a). This structure was verysimilar to striped bass hepcidin structure [3] and the secondarystructure (Fig. 3b) showed the cationic amino acids composedof twoarginines, two lysines and one histidine and no negative chargedaminoacids. Besides, it possesses a predicted molecular weight of2957.51 Da and an estimated net positive charge of þ3.4 (atpH ¼ 7.0). On the other hand, the predicted pI (8.34) resulted to beaverage among fish hepcidins, existing as high as in Acanthopagrusschlegelii (pI 9.34) [17] an as low as in Salmo salar (pI 7.73) [10].

3.2. Phylogenetic analysis

A previous report of hepcidin evolution showed that fishes havetwo classes of hepcidin, HAMP1 and HAMP2[29], whose expressionprofiles can be actually different [18,20] and probably witha different function [29]. Here we also found those classes, resultingthatA. immacultushepcidin isHAMP1class (Fig. 4). Everyfish specieshas only one copy of HAMP1 gene which is an orthologue ofmammalian sequences. The other multiple copies always fell intoHAMP2 group (only seen in Acanthopterygian fish) [29]. On theother hand, the phylogenetic tree showed a no clear segregation byecosystem (freshwater vs. marine) in both groups (HAMP1 andHAMP2). Although there are contrary opinions suggesting thathepcidin evolution and divergence is associated with theirsurrounding habitats and pathogens [30]. Nevertheless, our analysisshowed that the sequences of A. immaculatus and Lycodichthysdearboniwerehighly similar (92%), evenwhen theyare a temperate-water and Antarctic fishes, respectively. This suggests that in fishes,the environment does not play a strong selective pressure on hep-cidin evolution, being the other conditions which affects hepcidinevolution. Further studies need to be done in this context.

On the other hand, there might be segregation by taxa in eachgroup (HAMP1 and HAMP2). The big cluster of HAMP1 sequenceswere divided in threemain subclusters represented by Ostariophysi(Siluriformes and Cypriniformes) fish and Protacanthopterygii(Salmoniformes) fish for cluster 1, and Acanthopterygiifish (Perci-formes in cluster 2, and Pleuronectiformes in cluster 3). For theHAMP2 cluster the segregation of the subclusters was similar, butrepresented only by Acanthopterygian fish, where cluster 4, 6 and 7was represented by Perciformes and cluster 5 by Pleuro-nectiformes. Currently, HAMP2 sequences have only been found inacanthopterygians, and in some cases, clusters of multiple copies ofHAMP2 genes have arisen and diversified [29]. Particularly, HAM-P1of A. immaculatus resulted to be related to the Serranid fishEpinephelus moara with a sequence similarity of 96%. However, therest of the Serranid fish, Epinephelus coioides, Epinephelus awoara,Epinephelus bleekeri, Epinephelus malabaricus and Epinephelus fus-coguttatus were not grouped with A. immaculatus in the cluster 2(Fig. 4), because those hepcidins are HAMP2 class.

3.3. Tissue-specific hepcidin expression

The basal hepcidin expression analysis showed liver as thehighest relative expression tissue, and since the initial discovery of

hepcidin in humans, in almost all vertebrates, liver is the tissue thathas the highest hepcidin expression level [1,8,31,32]. One exceptionwas observed in the P. crocea, where liver was the lowest expres-sion tissue and kidney the highest [19]. In addition, we found anunexpected high basal relative expression level of hepcidin inmuscle (Fig. 5a), which is a tissue that has been not well studiedwith respect to hepcidin expression analysis in fishes. In the fewcases where expression inmuscle was observed, in Salmo salar [10],Sebastes schlegelii [25], Ictalurus punctatus [33] and Chrysophrysmajor [34], it was found at low levels, so further studies about therole that hepcidin may play in muscle are warranted. However,these results suggest hepcidin expression could be constitutive innot hematopoietic tissue as muscle in A. immaculatus. Similarresults have previously been reported by Fu et al. (2007) who foundhigh constitutive expression levels of HP2 in muscle of pigeonColumba livia [31]. With LPS exposure, hepcidin expressiontendency changed, being the main hematopoietic tissues (headkidney and spleen), the tissues with the highest relative expressionlevels, and liver remained as a high hepcidin expression tissue(Fig. 5b). Similar results were observed with HAMP1 in Lates cal-carifer, when it was exposed to intraperitoneal LPS injection,increasing hepcidin expression in liver and head kidney 3 h afterinjection [35], and in I. punctatus, when it was challenged withEdwardsiella ictaluri [33]. This expression could be result of theinflammatory response induced by LPS, which are capable toinduce this response by up-regulation of cytokines like IL-6, whichare involved in the cascade pathway of the acute phase responsewhere hepcidin has shown to be part of it [27].

4. Conclusion

Despite that several fish hepcidin genes have been identified,just a few efforts have sequenced the promoter region, which isnecessary to study its gene regulation. Here we presented thecomplete characterized HAMP1 gene of A. immaculatus, which issimilar to the Serranid fish E. moara and the Antarctic fishL. dearborni. This hepcidin possesses a very similar structure tostriped bass, and an average pI among the other fish hepcidins.

J. Masso-Silva et al. / Fish & Shellfish Immunology 31 (2011) 1297e13021302

Besides, the gene analysis revealed several putative transcriptionfactor binding sites, where the CEBPb, CEBPa, GATA, HNF3, NF-kBand c-Rel appears to be themost commonly found in fish hepcidins.In addition, the expression tendencies showed liver as the mostrelevant tissue in hepcidin expression. However, muscle showed anunexpectedly high basal relative expression level. On the otherhand, head kidney and spleen showed high hepcidin relativeexpression levels with LPS exposure, suggesting that these tissuesare strongly involved in hepcidin expression. Our results suggestthat the expression of HAMP1 gene of A. immaculatus in muscle atbasal conditions could represent a mechanism of protection againstthe invasion of pathogens before a strong stimuli. LPS exposurerevealed expression patterns showed by other authors, wherehematopoietic tissues are the principal organs involved with therapid response against the involved pathogens. These observationssuggest that further research focus on the transcription factoridentified here, to better understand hepcidin regulation in fishes,and to define its role in host defense.

Acknowledgements

This workwas supported by a grant (24334-CB-2005-01-48444)from the National Council of Science and Technology of Mexico(CONACyT) to FA.

References

[1] Krause A, Neitz S, Magërt HJ, Schulz A, Forssmann WG, Shuz-Knappe P, et al.LEAP-1, a novel highly disulfide-bonded human peptide, exhibits antimicro-bial activity. FEBS Lett 2000;480:147e50.

[2] Park CH, Valore EV, Warning AJ, Ganz T. Hepcidin, an urinary antimicrobialpeptide synthesized in the liver. J Biol Chem 2001;276:7806e10.

[3] Lauth X, Babon JJ, Stannard JA, Singh S, Nizet V, Carlberg JM, et al. Bass hep-cidin synthesis, solution structure, antimicrobial activities and synergism, andin vivo hepatic response to bacterial infections. J Biol Chem 2005;280(10):9272e82.

[4] Zhang J, Yan Q, Ji R, Zou W, Guo G. Isolation and characterization of a hepcidinpeptide from the head kidney of large yellow croaker, Pseudosciaena crocea.Fish Shellfish Immunol 2009;26:864e70.

[5] Wang YD, Kung CW, Chen JY. Antiviral activity by fish antimicrobial peptidesof epinecidin-1 and hepcidin 1-5 against nervous necrosis virus in medaka.Peptides 2010;31(6):1026e33.

[6] Chen JY, Lin WJ, Lin TL. A fish antimicrobial peptide, tilapia hepcidin TH2-3,shows potent antitumor activity against human fibrosarcoma cells. Peptides2009;30:1636e42.

[7] Lin B, Chen S, Cao Z, Lin Y, Mo D, Zhang H, et al. Acute phase response inzebrafish upon Aeromonassalmonicida and Staphylococcus aureus infection:striking similarities and obvious differences with mammals. Mol Immunol2007;44(4):295e301.

[8] Shike H, Lauth X, Westerman ME, Ostland VE, Carlberg JM, Van Olst JC, et al.Bass hepcidin is a novel antimicrobial peptide induced by bacterial challenge.Eur J Biochem 2002;269:2232e7.

[9] Ramey G, Deschemin JC, Durel B, Canonne-Hergaux F, Nicolas G, Vaulont S.Hepcidin targets ferroportin for degradation in hepatocytes. Hematologica2010;95(3):501e4.

[10] Douglas SE, Gallant JW, Liebscher RS, Dacanay A, Tsoi SCM. Identification andexpression analysis of hepcidin-like antimicrobial peptides in bony fish. DevComp Immunol 2003;27:589e601.

[11] Shike H, Shimizu C, Lauth X, Burns J. Organization and expression analysis ofthezebrafish hepcidin gene, an antimicrobial peptide conserved amongvertebrates. Dev Comp Immunol 2004;28:747e54.

[12] Lazarovici P, Primor N, Loew LM. Purification and pore-forming activity of twohydrophobic polypeptides from the secretion of the red sea moses sole(Pardachirus marmoratus). J Biol Chem 1986;261(35):16704e13.

[13] Cole AM, Weis P, Diamond G. Isolation and characterization of pleurocidin, anantimicrobial peptide in the skin secretions of the winter flounder. J BiolChem 1997;272(18):12008e13.

[14] Park IY, Park CB, Kim MS, Kim SC, Parasin I. An antimicrobial peptide derivedfrom histone H2A in the catfish, Parasilurus asotus. FEBS 1998;437:258e62.

[15] Uzzell T, Stolzenberg ED, Shinnar AE, Zasloff M. Hagfish intestinal antimi-crobial peptides are ancient cathelicidins. Peptides 2003;24(11):1655e67.

[16] Pigeon C, Ilyin G, Courselaud B, Leroyer P, Turlin B, Brissot P, et al. A newmouse liver-specific gene, encoding a protein homologous to human anti-microbial peptide hepcidin, is overexpressed during iron overload. J BiolChem 2001;276(11):7811e9.

[17] Yang M, Wang KJ, Chen JH, Qu HD, Li SJ. Genomic organization and tissue-specific expression analysis of hepcidin-like genes from black porgy (Acan-thopagrusschlegelii B.). Fish Shellfish Immunol 2007;23:1060e71.

[18] Huang PH, Chen JY, Kuo CM. Three different hepcidins from tilapia, Oreo-chromis mossambicus: analysis of their expressions and biological functions.Mol Immunol 2007;44:1922e34.

[19] Wang KJ, Cai JJ, Cai L, Qu HD, Yang M, Zhang M. Cloning and expression ofa hepcidin gene from a marine fish (Pseudosciaena crocea) and the antimi-crobial activity of its synthetic peptide. Peptides 2009;30:638e46.

[20] Kim YO, Hong S, Nam BH, Lee JH, Kim KK, Lee SJ. Molecular cloning andexpression analysis of two hepcidin genes from olive flounder Paralichthysolivaceus. Biosci Biotechnol Biochem 2005;69(7):1411e4.

[21] Hirono I, Hwang JY, Ono Y, Kurobe T, Ohira T, Nozaki R, et al. Two differenttypes of hepcidins from the Japanese flounder Paralichthys olivaceus. FEBS2005;272:5257e64.

[22] Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman JG, Smith JA, et al.Current protocols in molecular biology. New York: John Wiley & Sons; 2003.

[23] Ochman H, Gerber A, Hartl D. Genetic applications of an inverse polymerasechain reaction. Genetics 1988;120:612e23.

[24] Cho YS, Lee SY, Kim KH, Kim SK, Kim DS, Nam YK. Gene structure anddifferential modulation of multiple rockbream (Oplegnathusfasciatus) hepcidinisoforms resulting from different biological stimulations. Dev Comp Immunol2009;33:46e58.

[25] Kim YO, Park EM, Nam BH, Kong HJ, Kim WJ, Lee SJ. Identification andmolecular characterization of two hepcidin genes from black rockfish(Sebastesschlegelii). Mol Cell Biochem 2008;315:131e6.

[26] Ren H, Wang K, Zhou H, Yang M. Cloning and organization analysis of a hep-cidin-like gene and cDNA from Japan sea bass, Lateolabrax japonicas. FishShellfish Immunol 2006;21:221e7.

[27] Nemeth E, Valore EV, Territo M, Schiller G, Lichtenstein A, Ganz T. Hepcidin,a putative mediator of anemia of inflammation, is a type II acute-phaseprotein. Blood 2003;101:2461e3.

[28] Sow FB, Alvarez GR, Gross RP, Satoskar AR, Schlesinger LS, Zwilling BS, et al.Role of STAT1, NF-kB, and C/EBPb in the macrophage transcriptional regula-tion of hepcidin by mycobacterial infection and IFN-g. J Leukoc Biol 2009;86:1247e58.

[29] Hilton KB, Lambert LA. Molecular evolution and characterization of hepcidingene products in vertebrates. Gene 2008;415:40e8.

[30] Padhi A, Verghese B. Evidence for positive Darwinian selection on the hep-cidin gene of Perciform and Pleuronectiform fishes. Mol Divers 2007;11:119e30.

[31] Fu YM, Li SP, Wu YF, Chang YZ. Identification and expression analysis ofhepcidin-like cDNAs from pigeon (Columba livia). Mol Cell Biochem 2007;305:191e7.

[32] Hu X, Ward C, Aono S, Lan L, Dykstra C, Kemppainen RJ, et al. Comparativeanalysis of Xenopus tropicalis hepcidin I and hepcidin II genes. Gene 2008;426(1e2):91e7.

[33] Bao B, Peatman E, Li P, He C, Liu Z. Catfish hepcidin gene is expressed in a widerange of tissues and exhibits tissue-specific upregulation after bacterialinfection. Dev Comp Immunol 2005;29:939e50.

[34] Chen SL, Xu MY, Ji XS, Yu GC, Liu Y. Cloning, characterization, and expressionanalysis of hepcidin gene from red sea bream (Chrysophrys major. Antimi-crobial Agents Chemother 2005;49(4):1608e12.

[35] Barnes AC, Trewin B, Snape N, Kvennefors EC, Baiano JC. Two hepcidin-likeantimicrobial peptides in Barramundi Lates calcarifer exhibit differing tissuetropism and are induced in response to lipopolysaccharide. Fish ShellfishImmunol 2011;31(2):350e7.