Date post: | 04-Nov-2023 |
Category: |
Documents |
Upload: | irsp-ouidah |
View: | 0 times |
Download: | 0 times |
www.elsevier.com/locate/scihorti
Available online at www.sciencedirect.com
16 (2008) 280–290
Scientia Horticulturae 1Differences between native and introduced olive cultivars as revealed
by morphology of drupes, oil composition and SSR polymorphisms:
A case study in Tunisia
Hedia Hannachi a, Catherine Breton b, Monji Msallem c, Salem Ben El Hadj d,Mohamed El Gazzah a, Andre Berville e,*
a Faculte des Sciences de Tunis, Departement de Biologie, Campus Universitaire 2092, Tunis, Tunisiab AFIDOL, Maison des agriculteurs, 22 Avenue Henri Pontier, F-13626 Aix-en-Provence cedex 1, France
c Institut de l’Olivier, BP 208, 1082 Tunis, Tunisiad Institut National Agronomique de Tunisie, 43 avenue Charles Nicolle, 1082 Tunis, Mahrajene, Tunisia
e INRA, UMR DIA PC, Bat 33, 2 Place Viala, F-34060 Montpellier cedex 1, France
Received 14 September 2007; received in revised form 3 January 2008; accepted 10 January 2008
Abstract
Olive cultivars are diversified but nothing is known on their origins and if they are local or introduced in any regions. The study aims to
determine which traits may help to identify native from introduced cultivars and oleaster trees. We compared cultivars and oleasters from North
Tunisia to determine their relationships based on morphological traits, oil composition and SSR genotyping at seven loci. We used those parameters
to examine 32 cultivar trees from 17 denominations and 70 oleaster trees sampled. We used multivariate analysis, enabling to retain the best
variables, to establish relationships among trees based on morphological and pomological parameters. Gas chromatography was used to determine
fatty acid composition of 30 cultivar trees and 13 oleaster trees. We determined for one cultivar Gerboui the steady drupe, pit morphological and oil
composition variation ranges in six different contrasted agro-systems. SSR genotyping was performed in polyacrylamide gels after fluorescent
labelling. Based on morphology, oleaster trees from agro-ecosystems clustered broadly in an intermediate position between cultivars and oleasters
from natural ecosystems. SSR revealed that the feral and genuine oleasters plus cultivars are always overlapping. Relationships between cultivars
are displayed in two dendrograms. They revealed six and three main clusters based on Unweighted Pair Group Method (UPGMA) and Ward
algorithm, respectively. They mix olive cultivar and oleaster trees suggesting kinship relationships between some cultivar and some oleaster trees.
In contrast, on PCA, some morphological parameters split our sample approximately between olive and oleaster trees. Oil composition was similar
between cultivar and oleaster trees. Kinship relationships between cultivar and oleaster trees based on molecular polymorphisms suggested that
olive cultivars may have origin in local oleasters. Oil composition as fruit descriptors and drupe size appeared inefficient to discriminate between
olive and oleaster trees, in comparison to SSR. Our results suggested several domestication events for the olive. It is important to know which
cultivars have local origin to promote and sale products from Tunisia as from all around the Mediterranean basin.
# 2008 Elsevier B.V. All rights reserved.
Keywords: Domestication; Cultivar origins; Drupe morphology; Oil composition; Oil content; SSR; Olea europaea
1. Introduction
Olive growers question all around the Mediterranean basin
whether their olive cultivars have been introduced or are
derived from local oleasters. The olive and the wild olive or
oleaster border in many places, but little is known on their
* Corresponding author. Tel.: +33499612233; fax: +33467045415.
E-mail address: [email protected] (A. Berville).
0304-4238/$ – see front matter # 2008 Elsevier B.V. All rights reserved.
doi:10.1016/j.scienta.2008.01.004
relationships, and whether in each place oleaster are feral, i.e.,
they derived from the olive, or are genuine or natural (Lumaret
and Ouazzani, 2001) and the source of cultivars.
Distinction of a crop from its wild relatives is based on
several morphological traits and Botanists have usually made
distinct species of the two taxa (Gressel, 2005). There are
always ambiguities in the distinction, particularly when gene
flow between crop and wild is recurrent. Indeed, gene flow
leads to feral forms escaped from culture and established in
agro- and natural ecosystems. The olive, the feral olive and the
H. Hannachi et al. / Scientia Horticulturae 116 (2008) 280–290 281
oleaster may further create a complex set of individuals that
combine more or less traits from crop and wild. They display
continuous variation of traits used to distinguish them. Typical
cases have been described for sugar beet (Beta vulgaris L.) and
B. maritima L. in Europe (Santoni and Berville, 1992) and
sunflower/wild sunflower in the States (Whitton et al., 1997;
Reagon and Snow, 2006). Thus, morphological traits are
usually insufficient to distinguish among crop and wild and
breeders turn to molecular markers for help in distinction.
When the evolutionary study and domestication events of the
crop/wild relative couple is not known, in most cases the
distinction between crop and wild may be simple but some
individuals cannot be classified because they mixed traits and
molecular markers from the two classes as for weed beet and
sugar beet (Viard et al., 2004).
In Tunisia, the situation is exemplary and since the studies
by Camps-Fabrer (1953) many reports have shown the diversity
for the Tunisian olive (Trigui and Msallem, 2002), but little
attention has been given to the Tunisian oleaster. The
colonisations of Tunisia by Phoenicians, Greeks and Romans
make likely the introduction of foreign cultivars. However, the
oleaster is indubitably spontaneous in this area, and if local
domestication events occurred, we should expect tight relation-
ships between some cultivars and oleasters.
For the olive, criteria to establish relationships are based on
tree physiognomy, structure and size of fruits, pit and leaf
shapes, and dimensions. The set of criteria is commonly used
for cultivar distinction and identification. For oleasters there are
no criteria to describe fruits but it is logic to use those from
cultivars. Thus, we examined cultivar/cultivar and cultivar/
oleaster compared with the same criteria to look for similarities
on drupe shape parameters. For cultivars, the variation in drupe
morphology is huge. Twelve primary morphological descrip-
tors are listed for drupes and pits (Idrissi and Ouazzani, 2004).
Catalogues for olive cultivars display description and pictures
of trees and fruits of each denomination in different countries.
International Plant Genetic Resources Institute (IPGRI, Roma)
with International Olive Oil Council (IOOC, Madrid) have
regrouped most of them with their description (Bartolini et al.,
1998; Trigui and Msallem, 2002; Rotondi et al., 2003; Idrissi
and Ouazzani, 2004).
In general, oleasters display smaller (0.5–1.2 cm) fruit than
cultivars (1.2–4 cm), but many cultivars display small drupes as
oleasters as for Arbequina from Spain, Cailletier from France,
Frantoio from Italy, Koroneiki from Greece, and Chemlali from
Tunisia. Moreover, fruit size depends on cultivar genotype and
environment, but also variation is observed depending on the
load in fruits of trees that is different each year (C. Pinatel,
AFIDOL, Aix-en-Provence, France, Pers. comm.). Environ-
mental effects on fruit dimensions, pits morphology and fruit
composition have already been demonstrated for cultivars in
particular for long-lived stands of abandoned olive groves when
all human contributions to environment have disappeared
(Besnard et al., 2001). In these stands identification of a cultivar
denomination may be difficult. A rational comparison of olive
fruit dimension variation due to environmental conditions has
never been published and remains to be established. However,
most of olive cultivars have local distribution, and as example,
the local situation in North Tunisia, can be considered as
representative of the situation around the Mediterranean basin.
Tunisia displays adequate conditions to compare the olive and
oleaster since they are bordering in many locations. Distinction
between olive and oleaster trees is usually performed at local
situation, but this may repeat in plenty of regions all around the
Mediterranean basin.
To establish relationships between olive cultivar/cultivar and
cultivar/oleaster trees several molecular tools are widely used.
Here, we chose some Oe-SSRs that have been developed in
several teams (Sefc et al., 2000; Cipriani et al., 2002; Carriero
et al., 2002) of the series Oe-DCA, Oe-UDO, and Oe-GAPU.
For this first study we computed hierarchical analysis using
genetic distances aggregated with the Unweighted Pair Group
Method (UPGMA) and NJ methods. We first compared cultivar
to oleaster trees based on fruit morphology. Because the trees
grow in different ecosystems, we determined on Gerboui
cultivar which effects have different environments on those
morphological and oil parameters. All these characters were
used for olive and oleaster comparison. Those morphologic
traits that were stable in six different agro-ecosystems were
identified and their efficiency to establish relationships between
oleaster and cultivars from Tunisia was further verified. We also
verified whether olive oil fatty acid composition enables to look
for similarities. Moreover, we finally examined the poly-
morphisms for a few of SSR loci and we showed the similarities
as a dendrogram. Results are discussed from domestication
points of view and valorisation of commercial products.
2. Materials and methods
We sampled cultivar and feral oleaster trees in the agro-
ecosystems and other oleasters in natural ecosystems at
different locations. Thirty-two cultivar trees were sampled in
11 locations in different orchards (Table 1). Six individuals
from Gerboui were sampled in six orchards to study
environmental effect on pomological and oil parameters
(Table 2). Seventy oleaster trees were sampled either around
orchards in agro-ecosystems (42 trees) or in natural ecosystems
(28 trees). Feral oleaster trees in agro-ecosystems are bordering
with cultivars, in association with prickly pear (Opuntia ficus-
indica). In natural ecosystem, oleaster trees are isolated from all
cultural practices and environment, in association with
pistachio (Pistacia lentiscus).
Microsatellite markers (simple sequence repeat: SSR) were
applied onto DNAs from 15 olive cultivar and 52 oleaster trees,
31 in agro-ecosystems and 21 in natural ecosystems. Oil
composition was determined for 30 cultivar and 13 oleaster
trees, five in agro-ecosystems and eight in natural ecosystems.
The morphological and pomological parameters were deter-
mined on 32 cultivar and 40 oleaster trees, 24 in agro-
ecosystems and 16 in natural ecosystems (Table 1).
One hundred drupes and leaves were sampled on each tree.
Morphological and pomological parameters deal with trees,
leaves, fruits and pits. Statistics for each value is the mean of
100 leaves, drupes or pits. We noted 26 morphological
Table 1
List of individuals – cultivars and oleasters – in their different ecosystems
Code Cultivar/
oleaster
D O M Sample location/
governoratea
Fruit
weight (g)
Oil/FW (%) Geographical cultivated
areab/ecosystemsc
C1 Sayali + + + Slouguia/BA 3.98 23.67 Tunisia North: BA, EF,
JB, NL, SA, TS, ZN
C2 Chetoui1 + + + Slouguia/BA 3.38 27.04 Tunisia North: BA, BZ,
EF, JB, NL, SA, TS, ZN
C3 Chetoui2 � + + Laaroussa/SA � �C4 Chetoui3 � + + Laaroussa/SA � �C5 Chetoui4 � + + ElAlia/BZ � �C6 Marsaline1 + + + Slouguia/BA 3.28 18.97 NL, SA, TS, ZN
C7 Marsaline2 + + Laaroussa/SA � �C8 Chemlali1 + + + Slouguia/BA 0.80 17.26 BZ, NL,TS
C10 Meski1 + + + Slouguia/BA 3.40 14.67 BZ, NL, TS, ZN
C11 Meski2 � + + Dougga/BA � �C12 Meski3 � + + ElAlia/BZ � �C13 Neb Jmel + + + Testour/BA 2.34 23.92 Tunisia area cultivated
C14 Gerboui1 + + + Slouguia/BA 1.86 19.09 EF, JB, NL, SA, TS
C15 Gerboui2 � + + Testour/BA � �C16 Gerboui3 � + + Teboursouk/BA � �C17 Gerboui4 � + + Dougga/BA � �C18 Gerboui5 � + + Tunis/TS � �C19 Gerboui6 � + + Seliana/SA � �C20 Besbessi1 + + + Testour/BA 2.90 17.03 BZ, NL, SA TS, ZN
C21 Besbessi2 � + + Laaroussa/SA � �C22 Chaıbi1 + + + Teboursouk/BA 1.01 16.98 Tunisia North
C23 Chaıbi2 � + + Teboursouk/BA � �C24 Chaıbi3 � + + Teboursouk/BA � �C25 Chaıbi4 � + + Laaroussa/SA � �C26 Tounsi + + + Teboursouk/BA 1.27 19.80 NL, ZN
C27 Roumi + + + Teboursouk/BA 1.11 20.79 BZ, JB,TS
C28 Zarras + + + Teboursouk/BA 2.32 29.11 TS
C29 Limi + + + Teboursouk/BA 1.01 16.59 NL, TS
C30 Rajou + � + Rasjbel/BZ � � BZ, NL, TS
C31 Nibd + � + Rasjbel/BZ � �C32 Souihli � + + Dougga/BA 1.38 26.81 NL, TS
C33 Awame � + + Dougga/BA 1.25 23.78
O1 Oleaster + + + Slouguia/BA 0.45 9.44 Agro-ecosystem
O3 Oleaster + � + Testour/BA 0.62 Agro-ecosystem
O4 Oleaster + + + Testour/BA 0.62 10.99 Agro-ecosystem
O5 Oleaster + � � Teboursouk/BA � � Agro-ecosystem
O6 Oleaster + + + Teboursouk/BA 0.7 15.06 Natural ecosystem
O7 Oleaster + + + Ichkeul/BZ 0.24 7.59 Natural ecosystem
O8 Oleaster + + + Ichkeul/BZ 0.38 8.35 Natural ecosystem
O9 Oleaster + + + Ichkeul/BZ 0.35 8.02 Natural ecosystem
O10 Oleaster + � � Ichkeul/BZ � � Natural ecosystem
O11 Oleaster + � � Ichkeul/BZ � � Natural ecosystem
O12 Oleaster + � � Ichkeul/BZ � � Natural ecosystem
O13 Oleaster + � � Ichkeul/BZ � � Natural ecosystem
O15 Oleaster + � + RasJbel/BZ 0.84 � Agro-ecosystem
O16 Oleaster + � � RasJbel/BZ � � Agro-ecosystem
O17 Oleaster + + + Tunis/TS 0.34 10.83 Natural ecosystem
O18 Oleaster + + Tunis/TS � � Natural
O19 Oleaster + + + Tunis/TS 0.31 9.11 Natural ecosystem
O20 Oleaster + + + Tunis/TS 0.33 8.81 Natural ecosystem
O21 Oleaster + � + Messaoudi/EF 0.52 Agro-ecosystem
O22 Oleaster + � � Midian/EF � � Natural ecosystem
O23 Oleaster + � � Bahra/EF � � Agro-ecosystem
O25 Oleaster + � � Ettouiref/EF � � Natural ecosystem
O26 Oleaster + � � Ettouiref/EF � � Natural ecosystem
O27 Oleaster + � � Jendouba/JB � � Natural ecosystem
O28 Oleaster + � � Fernana/JB � � Agro-ecosystem
O29 Oleaster + � � Jendouba/JB � � Natural ecosystem
O30 Oleaster + + Tbaba/JB 0.29 � Agro-ecosystem
O31 Oleaster + � � Zouaraa/BA � � Agro-ecosystem
O32 Oleaster + � � Zouraa/BA � � Agro-ecosystem
H. Hannachi et al. / Scientia Horticulturae 116 (2008) 280–290282
Table 1 (Continued )
Code Cultivar/
oleaster
D O M Sample location/
governoratea
Fruit
weight (g)
Oil/FW (%) Geographical cultivated
areab/ecosystemsc
O33 Oleaster + � � Tamra/BA � Agro-ecosystem
O34 Oleaster + � + Sejnan/BZ 0.35 � Agro-ecosystem
O35 Oleaster + � � Sejnan/BZ � � Agro-ecosystem
O36 Oleaster � � + Mateur/BZ 0.64 � Agro-ecosystem
O37 Oleaster + � � AınGhlal/BZ � � Agro-ecosystem
O38 Oleaster + � + JbelElwesr/ZN 0.44 � Natural ecosystem
O39 Oleaster + � + Zaghouan/ZN 0.51 � Agro-ecosystem
O40 Oleaster + � � Zriba/ZN � � Agro-ecosystem
O41 Oleaster � � + Zriba/ZN 0.67 � Agro-ecosystem
O42 Oleaster + � � Jradou/ZN � � Agro-ecosystem
O43 Oleaster + � � Jradou/ZN � � Agro-ecosystem
O44 Oleaster + � � OuedKenz/ZN � � Natural ecosystem
O45 Oleaster + � � Batria/ZN � � Agro-ecosystem
O46 Oleaster + � + Saouaf/ZN 0.46 � Agro-ecosystem
O47 Oleaster + � � OuedTouil/ZN � � Agro-ecosystem
O49 Oleaster � � + Joudar/ZN 0.21 � Agro-ecosystem
O48 Oleaster + � � Saouaf/ZN � � Agro-ecosystem
O51 Oleaster + + + MjezElbab/BA 0.57 10.96 Agro-ecosystem
O52 Oleaster + � � Kelibia/NL � � Agro-ecosystem
O53 Oleaster + � � Kelibia/NL � � Agro-ecosystem
O55 Oleaster + � � Kelibia/NL � � Agro-ecosystem
O56 Oleaster + � + Kelibia/NL 0.91 � Agro-ecosystem
O57 Oleaster + � + Kelibia/NL 0.90 � Agro-ecosystem
O58 Oleaster � � + Echraf/KA 0.36 � Agro-ecosystem
O59 Oleaster + � + Echraf/NL 0.89 � Agro-ecosystem
O60 Oleaster � � + Echraf/KA 0.52 � Agro-ecosystem
O61 Oleaster + � � Abderrahman/NL � � Natural ecosystem
O63 Oleaster � � + Abderrahman/NL 0.44 � Natural ecosystem
O64 Oleaster + � + Abderrahman/NL 0.35 � Natural ecosystem
O65 Oleaster � � + Zaghouan/ZN 0.45 � Natural ecosystem
O66 Oleaster � � + Zaghouan/ZN 0.48 � Natural ecosystem
O67 Oleaster � � + Zaghouan/ZN 0.64 � Agro-ecosystem
O68 Oleaster � � + Zaghouan/ZN 0.86 � Agro-ecosystem
O69 Oleaster � � + Azmour/NL 0.68 � Agro-ecosystem
O70 Oleaster � � + Azmour/NL 0.81 � Agro-ecosystem
O71 Oleaster � � + Azmour/NL 0.35 � Natural ecosystem
O72 Oleaster � � + Azmour/NL 0.35 � Natural ecosystem
O73 Oleaster � � + Azmour/NL 0.33 � Natural ecosystem
O74 Oleaster � � + Azmour/NL 0.24 � Natural ecosystem
O77 Oleaster � + + Dougga/BA 0.85 13.43 Agro-ecosystem
O78 Oleaster � + + Laaroussa/SA 0.65 12.83 Agro-ecosystem
(+) For columns D, O, M, mean DNA, oil and the morphology were studied, respectively; (�) means not determined.a Governorates are BA: Beja; BZ: Bizerte; EF: El Kef; JB: Jendouba; NL: Nabeul; SA: Seliana; TN: Tunis; ZN: Zaghouan.b Cultivated geographical area were determined by several authors (Minangoin, 1901; Decrully, 1907; Valdeyron and Crossa-Raynaud, 1950; Mehri and Hellali,
1995; Mehri et al., 1997; Trigui and Msallem, 2002).c Oleaster ecosystems.d This cultivar (Nib) was not previously identified.e This cultivar (Awam) was only indicated by Hannachi et al. (2006).
Table 2
The different locations and agro-ecosystems with climate characteristics according to Mtimet (1999) where the Gerboui cultivar was sampled
Code for Gerboui
locations
Location Elevation
(m)
Soil Annual means
raining (mm)
Annual means
temperature
Bioclimatic stage
1 Slouguia 112 Mediterranean red soil 597 17.8 8C Sub-humid at mild winters
2 Testour 112 Calco-marly 597 17.8 8C Sub-humid at mild winters
3 Teboursouk 440 Calco-marly 597 16.5 8C estimation Sub-humid at mild winters
4 Dougga 365 Lime pit 597 17.3 8C Sub-humid at mild winters
5 Tunis 66 Marly 411 18 8C Semi-arid superior
6 Seliana 431 Calco-magnesium 440 16.5 8C estimation Semi-arid
Estimation: means corrected according to elevation.
H. Hannachi et al. / Scientia Horticulturae 116 (2008) 280–290 283
Table 3
List of morphological variables and their codes and meaning according to the International Olive Oil Council
Code Variables Intensity
Vr1 Tree vigour 1 Weak 2 Medium 3 Strong
Vr2 Tree habit 1 Falling down 2 Spread out 3 Erected
Vr3 Canopy density 1 Loose 2 Medium 3 Compact
Vr4 Inter-node length 1 Short 2 Medium 3 Long
Vr5 Leaves shape 1 Elliptic 2 Elliptic-lanceolate 3 Lanceolate
Vr6 Stem length 1 Short 2 Medium 3 Long
Vr7 Stem width 1 Narrow 2 Medium 3 Wide
Vr8 Drupe weight 1 Low (<2 g) 2 Medium (2–4 g) 3 High (4–6 g) 4 Very high (>6 g)
Vr9 Drupe shape 1 Spherical 2 Oval 3. Longer
Vr10 Drupe symmetry (position A) 1 Symmetrical 2 Lightly asymmetrical 3 Asymmetrical
Vr11 Drupe polar diameter location 1 To bottom 2 Medium 3 To top
Vr12 Drupe top (position A) 1 Sharp 2 Rounded
Vr13 Drupe bottom (position A) 1 Cut 2 Rounded
Vr14 Knoll 1 Absent 2 Outlined 3 Evident
Vr15 lenticels 1 Little numerous 2 Numerous
Vr16 Dimension of lenticels 1 Small 2 Big
Vr17 Pit weight 1 Low (<0.3 g) 2 Medium (0.3–0.45 g) 3 High (0.45–0.7 g) 4 Very high (>0.7 g)
Vr18 Pit shape 1 Spherical 2 Oval 3 Elliptic 4 Longer
Vr19 Pit symmetry (position A) 1 Symmetrical 2 Lightly asymmetrical 3 Asymmetrical
Vr20 Pit symmetry (position B) 1 Symmetrical 2 Lightly asymmetrical
Vr21 Pit diameter Position 1 To bottom 2 Medium 3 To top
Vr22 Pit top 1 Sharp 2 Rounded
Vr23 Pit bottom 1 Cut 2 Sharp 3 Rounded
Vr24 Pit surface 1 Smooth 2 Rough 3 Knotty
Vr25 Numbers of grooves 1 Reduced (<7) 2 Medium (7–10) 3 High (>10)
Vr26 Top extremity 1 Without mucron 2 With mucron
H. Hannachi et al. / Scientia Horticulturae 116 (2008) 280–290284
parameters for each tree, plus the vigour, the shape and the
density of the canopy. For stem and leaf parameters we
determined mean length of inter-node, mean length, mean
width and shape of the leaves (ratio length width). For fruit,
polar and transversal diameters, as weight were determined. For
pits, polar and transversal diameters, weight, numbers of
grooves were determined. Some qualitative variables were also
determined and in this case we used the way proposed by the
IOOC (Madrid) to attribute one number to each class of the
variables (Table 3).
2.1. Lipid extraction
We used the Allen and Good (1971) protocol on 5 g of
drupes that were fixed to neutralize lipase activities. Oil
extraction was carried out in chloroform and methanol.
The lipid residue was eliminated with salt water (1% NaCl).
The homogenate was centrifuged at 3000 � g. The chloro-
form phase was conserved in (1:4, v:v) toluene and
ethanol (Vorbeck and Marinetti, 1965). Methylation was
performed in methalonic soda at 65 8C for 15 min.
Transmethylation was performed with boron trifluorure at
65 8C for 5 min. The mixture of methylic esters was run on a
gas chromatograph (Girdel, 300c) with margaric acid (C17:0)
as internal standard. Oil content was determined by the
Soxhlet method, using hexane as extraction solvent. Oil
extraction was applied on 30 cultivars (from 11 locations)
and 13 oleasters, eight in the natural- and five in the agro-
ecosystems.
2.2. Molecular markers
DNA was extracted from leaves freshly collected using the
method described by Besnard et al. (2000). We used the SSR
developed by Sefc et al. (2000), Cipriani et al. (2002) and
Carriero et al. (2002) Oe-SSR-DCA (1, 5, and 9), Oe-SSR-
UDO (12, 17, and 24), and Oe-SSR-GAPU101, respectively,
which were chosen for the size and numbers of alleles. Ladders
and amplification products labelled using the tailing method
with the Fam fluorochrome, were separated onto 8%
polyacrylamide gels enabling reading with a HITACHI scanner
system associated at the FMBIO2 software. Seven olive
microsatellite loci (Table 4) were examined in 52 oleaster and
15 cultivar trees (Table 1) in order to determine the SSR
polymorphism and the relationships between some Tunisian
olive and oleaster trees. PCR reactions were performed in
12.5 ml final volume, containing 40 ng genomic DNA,
0.75 mM MgCl2, 2.5 mM dNTP, 1.25 U Taq polymerase and
0.19 mM M13-Fam. Amplifications were performed in a
thermal cycler Gradient 96 Robocycler, Stratagene, Germany)
The amplification program was: 94 8C for 1 min, 52 8C for
1 min, 72 8C for 1 min, followed by 35 cycles at 94 8C for 30 s,
at 50 8C for 45 s, and 72 8C for 1 min, with a final elongation
cycle at 72 8C for 4 min.
2.3. Statistical analysis
ANOVA was used once verified all data for normal
distribution. Principal Component Analyses were computed
Table 4
List of the SSR used, repeated motif and primer sequences
Locus Repeated motif Directed sequence (50–30) Reverse sequence
Ssr Oe-UA-DCA1 (GA)22 cctctgaaaatctacactcacatcc atgaacagaaagaagtgaacaatgc
Ssr Oe-UA-DCA5 (GA)15 aacaaaatcccatacgaactgcc cgtgttgctgtgaagaaaatcg
Ssr Oe-UA-DCA9 (GA)23 aatcaaagtcttccttctcatttcg gatccttccaaaagtataacctctc
Ssr Oe-Gapu101 (GA)8(G)3(AG)3 catgaaaggagggggacata ggcacttgttgtgcgattg
Ssr Oe-Udo012 (GT)10 tcaccattcttaacttcacacca tcaagcaattccacgctatg
Ssr Oe-Udo017 (TG)11 tcaccattcttaacttcacacca tcaagcaattccacgctatg
Ssr Oe-Udo024 (CA)11(TA)2(CA)4 ggatttattaaaagcaaaacatacaaa caataacaaatgagcatgataagaca
H. Hannachi et al. / Scientia Horticulturae 116 (2008) 280–290 285
on the data using the software Statistica (Sta Soft Inc.,
Johannesburg, ZA). We first look for a global structure using
PCA and then we computed correlation between variables. The
principle of PCA is to compute variables as components of axes
that are independent. We also computed discriminate analyses
by declaring trees as oleaster or cultivar and as oleaster, feral or
cultivar to look for eventual variable threshold. Clusters
analyses and construction of dendrograms were performed with
UPGMA and Ward (1963) algorithm to aggregate Nei (1972)
genetic distances. UPGMA does not weight genetic distances
whereas Ward maximises the differences. The genetic matrix
was treated by Philips software with the drawgram pro-
grammes.
3. Results
ANOVA analysis was performed on all quantitative traits
(pomological and oil parameters) of six Gerboui individuals to
Table 5
Means and variation of traits for fruits, pits and oil composition measured at six c
Organs Traitsa 1b 2 3
Drupes DL (mm) 18.87 13.59 20.74
DD (mm) 14.11 11.58 16.77
DW (g) 1.91 1.05 2.79
DL/DD 1.33 1.17 1.23
Pits PL (mm) 14.64 10.54 13.08
PD (mm) 7.68 6.82 7.22
PL/PD 1.90 1.54 1.82
PW (g) 0.43 0.29 0.44
NPG 8.16 7.22 7
Oil (%) C16:0 19.97 14.65 13.12
C18:0 2.61 3.49 2.52
C20:0 0.46 0.59 0.34
SFA 23.04 18.74 15.99
C16:1 1.68 0.72 0.99
C18:1 52.13 58.18 64.34
C18:2 21.36 21.99 14.40
C18:3 0.9 1.09 0.84
UFA 76.08 81.99 80.58
SA 23.04 18.74 15.99
OC/FW 19.09 17.15 21.43
OC/DM 48.01 40.79 50.11
a Pomological and oil parameters = drupe length (DL), drupe diameter (DD), dru
shape (PL/PD), pit weight (PW), number of fibro vascular furrows (NPG). Palmitic ac
acid (C18:2), linolenic acid (C18:3), arachidic acid (C20:0), saturated fatty acid (SFA
matter (OC/DM).b 1–6 refer to the six locations for Gerboui (Table 2).c S: (***) significant 0.01; (**) significant 0.05; (NS) not significant.
estimate eventual location effects. It did not reveal environ-
mental effect for the main oil parameters such as stearic (C18:0),
linoleic (C18:2) and arachidic (C20:0) acids. The palmitic (C16:0),
and linoleic (C18:1) acid variation was just significant at 5%
whereas oil content on fresh weight and dry matter (OC/FW,
OC/DM), unsaturated (UFA), saturated (SFA) fatty acids,
palmitoleic (C16:1) and linolenic (C18:3) acids varied signifi-
cantly (Table 5). In contrast, most pomological parameters
varied significantly according to location, except the number of
pit grooves (NPG) did not vary and pit shape (PL/PD) varied
just significantly at 5%.
We computed a PCA on the whole morphologic and
physiognomy data to look for a structure (Fig. 1a). Ratios such
as fruit shape (DL/DD), the leaf (LL/LD) and the pit shape (PL/
PD) were declared as supplementary variables. The remaining
parameters (23 parameters) were active variables. Axis 1
explained 22.59% of the inertia, and was mainly made by the
tree vigour (Vr1), mean length of inter-node (Vr4); shape (Vr5),
ultivation areas for the Gerboui cultivar
4 5 6 Sc genetics Sc location
13.53 21.04 13.96 *** ***
12.70 19.31 12.38 *** ***
1.11 4.14 1.47 *** ***
1.06 1.08 1.12 *** ***
9.29 12.15 9.08 *** ***
6.62 8.49 6.27 *** ***
1.40 1.43 1.45 *** **
0.26 0.45 0.27 *** ***
6.4 8.32 8.12 *** NS
15.71 14.75 16.07 *** **
3.25 3.01 2.87 *** NS
0.43 0.47 0.72 *** NS
19.39 18.23 19.66 *** ***
0.95 0.72 1.23 *** ***
46.47 57.88 58.04 *** **
30.50 24.16 19.30 *** NS
0.82 0.86 0.86 *** ***
78.74 83.63 79.44 *** ***
19.39 18.23 19.66 *** ***
19.83 18.32 28.41 *** ***
43.59 42.03 54.73 *** ***
pe weight (DW), drupe shape (DL/DD), pit length (PL), pit diameter (PD), pit
id (C16:0), palmitoleic acid (C16:1), stearic acid (C18:0), oleic acid (C18:1), linoleic
), unsaturated fatty acid (UFA), oil rate/fresh weight (OC/FW), oil content/dry
Fig. 1. (a) Principal Component Analysis on morphological parameters determined on 40 oleasters (16 oleasters from natural ecosystem (o) and 24 oleasters from
agro-ecosystem (O) and 33 cultivars (C) on 7 locations). The fleshes show the cultivars C32 and C33 located in oleasters group. (b) Variables of PCA on
morphological parameters ((+) active variables; (*) additional variables).
Fig. 3. Discriminate analysis on morphological variables determined in 40
oleasters (16 oleasters (O) from natural ecosystem and 24 oleasters from agro-
H. Hannachi et al. / Scientia Horticulturae 116 (2008) 280–290286
length (Vr6), and width (Vr7) of leaves; drupe weight (Vr8),
drupe shape bottom (Vr13) and presence or absence of knoll
(Vr14), pit weight (Vr17), diameter position (Vr21). Axis 2
explained 10.95% of the inertia and is made by tree habit (Vr2),
drupe symmetry (Vr10), pit shape (Vr18), symmetry (Vr19
position A), symmetry (Vr20 position B), shape bottom (Vr23),
and top extremity (Vr22), and presence or absence of mucron
(Vr26). Correlated variables with axes 1 and 2 are displayed in
Fig. 1b. The dispersion of individual on the plan defined by axes
1 and 2 showed that two tree cultivars C32 (Souihli, North
West) and C33 (Awam, North West) overlapped with oleaster
trees. The upper right dial defined by big drupes and pits
contains cultivars only, whereas the dial for small drupes and
pits mixed oleaster and cultivar trees (Fig. 1a).
We then compared cultivars and oleasters from the natural
ecosystem removing oleasters that may be feral (Fig. 2). The
two clouds of trees still overlapped. The two taxa are
discriminate based on morphological parameters but we noted
that the two cultivars Souihli (C32) and Awam (C33) were also
clustered with oleasters. These cultivars produce small fruits.
To compute DCA we declared trees according to their
locations in the ecosystems. The morphological and pomolo-
gical parameters showed a continuous variation. In this analysis
Fig. 2. Principal Component Analysis on morphological parameters deter-
mined on 16 genuine oleasters and 33 cultivars on seven locations once
eliminated feral oleasters (C: variety; O: oleaster from natural ecosystem).
we considered all oleaster and olive trees (Fig. 3) and we they
still overlapped.
PCA for fatty acid composition of 30 cultivar and 30 oleaster
trees (Fig. 4) appeared inefficient to define any relationship
between oleaster and olive. However, the PCA analysis was
applied on fatty acids composition and oil content, the later
appeared more efficient to note the relationship between
Fig. 4. Principal Component Analysis on oil parameters determined on 13
oleasters (8 oleasters from natural ecosystem (O) and 5 oleasters from agro-
ecosystem, and 20 cultivars (C) on seven locations.
ecosystem and 33 cultivars (C) on seven locations.
Fig. 5. Principal Component Analysis on oil content and fatty acids composi-
tion determined on 13 oleasters (8 oleasters from natural ecosystem (o) and 5
oleasters from agro-ecosystem, O) and 20 cultivars (C) on seven locations.
H. Hannachi et al. / Scientia Horticulturae 116 (2008) 280–290 287
oleaster and olive (Fig. 5). Axis 1 of this analysis was correlated
with oil fruit content, rate of C16:1, C18:0 and C18:1. The axis 2
was defined by the rate of C18:2, C18:3 and C20:0. In this case we
noted that most variables defined these axes (axes 1 and 2) of
CPA analysis (oil content, C16:1, C18:1, C18:3) were variable
according to location (shown with Gerboui individual). Fatty
acids which varied according to places for Gerboui are not
effective to establish kinship relationships between cultivars
and oleasters.
The SSR data were used to detect their reliability to establish
genetic relationships among the oleaster and cultivated olive
trees. Clustering analysis using UPGMA method shows six
groups (Fig. 6a). The group-1 clusters most of olive trees, it
contains 12 oleaster trees from several locations (O6, O3, O32,
O42, O9, O34, O8, O40, O26, O22, O35, O13) and 11 out of 15
cultivars (C1, C6, C10, C30, C29, C26, C14, C20, C28, C13,
C22). The group-2 contains nine oleaster and two olive trees
(C8 Chemlali and C27 Roumi). The group-3 contains two
cultivar (Chetoui C2 and Nib C31) and six oleaster trees. The
groups 4 and 5 contain only oleasters. O11 is single. Three
groups contain olive and oleaster trees and two groups contain
only oleaster trees.
Clustering analysis using NJ method (Fig. 6b) shows three
groups. Each group was composed with several clusters. The
group-1 contains 17 oleaster and 2 olive trees (Sayali C1,
Chemlali C8). It was composed with two clusters: cluster-1
contains two olive trees (C1, C8) and cluster-2 contains only
oleasters. The group-2 contains 13 oleaster and 4 olive trees. It
was composed by two clusters that contain olive and oleaster
trees. The group-3 contains 22 oleaster and 9 olive trees. It
divided on seven clusters. Three clusters of this group contain
only oleaster and four clusters contain olive and oleaster trees.
The distribution in mixture of the two olive taxa shows that
probably tightly relationships do exist between some oleasters
and olive cultivar independently of locations.
We examined the clusters supposing that feral oleaster trees
have escaped from cultivars. In Fig. 6a, group 1 is composed of
natural and feral oleasters and cultivars. Sayali C1 is very
closely related to O6 from Beja and Chemlali C8 (group 2) is
related to O61 and O19 from Tunis and Nabeul. Roumi (group
2) is close to Chemlali and to natural oleasters from Tunis. In
Fig. 6b Chemlali group1 and Roumi are in different clusters but
closely related to the same oleasters from natural sites. Chetoui
C2 (Fig. 6b, group 3) is also closely related to two oleasters
from natural sites (O11 Ichkeul – Bizerte, O29 Jendouba). In
Fig. 6a groups 4 and 5 do not include cultivars and In Fig. 6b,
groups 2 and 4 mix natural and feral oleaster and oleasters plus
cultivars, but less consistently than proceeding (Fig. 5).
4. Discussion
We sampled all trees recording ecosystem data, expecting
that oleaster trees will split in genuine and feral in the natural-
and agro-ecosystem, respectively. Oleasters were broadly split
mainly based on morphological parameters declared between
trees from natural ecosystems versus those from the agro-
ecosystems (Table 3).
Cultivars showed a continuous variation broadly by drupe
sizes. The morphological parameters show only partial
separation between oleaster and cultivar trees (Fig. 1a,
Table 1). The class of cultivars with small fruit was close to
oleasters. Because of the vegetative propagation, an oleaster
propagated in an orchard will conserve more or less small fruits.
The later class was intermediate between cultivars with small
fruits and oleaster trees. Once eliminated the class of feral olive
keeping all cultivars together, some cultivated olive trees with
the smallest fruits were still mixed with oleasters (Fig. 2). This
suggests that they may belong to the oleaster pool. Fatty acid
composition was similar between oleaster and cultivated olive
trees, but inefficient to define relationships between them
(Fig. 4) in contrast to the oil content used on PCA analysis
(Fig. 5). Oil content is the most efficient parameter to split
between oleaster and cultivar trees.
The SSR markers revealed that cultivar and oleaster trees
from North Tunisia cluster together in the dendrograms. Based
on similarities we can conclude that they shared close
relationships (Fig. 6a and b).
Based on SSR markers, oleaster and olive trees shared close
relationships. Oleaster forests are natural in Tunisia and several
historical reports (Camps-Fabrer, 1953, 1997) have pointed out
that the oleaster is native in Tunisia. Breton et al. (2006b) have
pointed out that modern Tunisian oleasters are issued from one
refuge area. Moreover, the molecular diversity revealed in
oleasters and a few of Tunisian cultivars (Breton et al., 2006a)
has suggested that a few of cultivars are issued from the
Tunisian oleaster based on assignation and admixture analyses.
It is logic to suppose that cultivars that share tight similarities
with natural oleasters may have they origin in the correspond-
ing oleaster population. However, we have noticed that feral
oleasters are frequent and some cannot be distinguished from
native. Consequently, we cannot exclude that some natural
oleaster could be feral.
Domestication had taken place 5800–5900 years ago for
olive (Zohary and Spiegel Roy, 1975; Galili et al., 1988).
Moreover, cultivars have been further differentiated for
adaptation and uses. At the morphological level, it is likely
Fig. 6. Dendrograms of 52 oleaster (O) and 15 olive cultivated trees (C), based on SSR data, using (a) UPGMA algorithm; (b) Ward algorithm. The arrows indicate the
genuine oleasters and some related cultivars.
H. Hannachi et al. / Scientia Horticulturae 116 (2008) 280–290288
that drupe size has been increased for table uses, but it is also
conceivable that for oil extraction the size of the drupes is not
important to high oil yield. Consequently, this suggests
expecting a genetic structure in cultivars due to drupe size.
However, selection pressures exerted for increasing fruit size
and probably also oil content have diversified the cultivars that
now, based on fruit morphology did not still resemble to
oleaster fruits.
It is now documented that several domestication events
occurred according to pit morphology (Terral et al., 2004)
H. Hannachi et al. / Scientia Horticulturae 116 (2008) 280–290 289
molecular markers such as RAPD, SSRs and cytoplasmic
DNAs (Besnard and Berville, 2002; Breton et al., 2005). Terral
and Arnold-Simard (1996), Terral (1997b), and Terral et al.
(2004) have proved such events in different regions of the
Mediterranean basin. Probably, they occurred concomitantly
with domestication in the Near East (Lanfranchi and Bui, 1995;
Terral, 2000). Thus, present olive cultivars may display
diversity according to domestication origins (Breton et al.,
2006a). The effect of cultivation on wild trees was evaluated by
Terral and Arnold-Simard (1996) on wood anatomy, sap
conduction, growth and development. Terral (1997a) has
carefully shown that after pruning, oleaster trees produced
larger fruits but the ratio length/diameter was not modified.
This suggests that cultivation caused swollen of the fruits and
olive growers consider that cares on such trees, increase
significantly fruit size. However, the design of a rational
experiment to check parameters on olive-oleaster is too long
and expensive.
Seed gene flow is locally detected when in a region cultivars
have been introduced and local oleasters do not carry the same
cytoplasm (Besnard and Berville, 2002). Pollen gene flow is
recurrent in both direction but we do not know their
evolutionary consequence. However, in case of drupe dispersal
they progenies are hybrid olive–oleaster and may blur the
distinction. We effectively obtained a better distinction when
we eliminated feral trees from analyses (Fig. 2). Cultivars that
bear large fruits (>2 cm) are usually used for table (canning)
and cultivars with small fruits (<2 cm) are mainly for
producing oil. However, there are many exceptions, i.e.,
Cailletier producing small fruits is used for canning but only the
big fruits are used for canning, the remaining olives are used for
oil. Fruit size is influenced by fertilization, watering and the
load of each tree. The average size of drupes on a tree is
therefore due to complex genetic and environment parameters
interfering with the year for observation. Domestication has
always been based on a narrow genetic basis and consequently
the reduction in polymorphisms is mainly due to genetic drift.
A priori, the probability to find a locus under selection is weak,
whereas genetic drift affects all the genome of the crop. This
explains that molecular markers such as Isozymes, RAPD, and
SSRs, are efficient to distinguish crop from wild in most of
examined loci (Lumaret et al., 1997; Besnard and Berville,
2000; Breton et al., 2005).
Olive cultivars appeared diversified in Tunisia. One group of
cultivars appeared in tight relationships with local oleasters that
suggest cultivars Chetoui, Chemlali and Roumi could derive
from domestication of oleasters. However, oleasters could also
derive from introduced cultivars. Historical and archaeological
data are scarce. They could say only whether cultivars have been
domesticated locally or have been introduced from elsewhere.
In comparison with other crop/wild couples, we look for
explanations to this situation in the olive/oleaster couple. A
priori we expected morphological differences between olive
cultivar and oleaster trees due to the differences in genotypes
and because they grow in agro- and natural ecosystems,
respectively. Such expectations are reported for plenty of
crop—wild couples (Gressel, 2005). The effect of domestica-
tion in olive is still unclear and if some authors considered fruit
size as main modification (Lumaret and Ouazzani, 2001) other
authors considered rather fruit oil content (Breton et al., 2006b).
Consequently, the olive/oleaster couple is an original example
of crop/wild complex because they are not fully separated.
Olive oil composition displays a range of composition for fatty
acids (saturated, mono-unsaturated, and poly-unsaturated)
according to cultivars and environment that leads to olive oil
appellations, but little attention has been brought to oil
composition in oleaster trees. Surprisingly, oleaster and cultivar
trees display the same range of variation.
The morphological parameters showed a continuous
variation between cultivated olive tree and oleaster, but they
defined two extreme classes based on drupe size (small and big
fruits). These parameters appeared more efficient when they
were associated with ecosystems for the oleaster trees. In
contrast, the oil content and fatty acid composition used
together define oleaster and cultivar relationships. Moreover,
SSR are the most efficient to establish relationships between
oleasters and cultivated olive trees.
Chemlali has unambiguously conserved the fruit morphol-
ogy of an oleaster. The oil content is much high than in other
cultivars and Chemlali could be due to local domestication.
Standards for olive oil as for Protected Geographical Indication
(PGI) appellations fix the lower value for oleic acid (55%).
Variation in oil composition enabled to distinguish cultivars
(Ollivier et al., 2003), but was never used to study oil cultivar
and oleaster trees. A local origin of a cultivar, as Chemlali, may
document geographic labels to valorise products.
Acknowledgements
Thanks are due to Abderazzek Bousselmi & Samira Melek
(Institut de l’Olivier Tunis) for helpful technical assistance.
References
Allen, C., Good, P., 1971. Acyl lipids in photosynthetic system. In: Clowic,
S.P., Kaplan, N.O. (Eds.), Methods in Enzymology. Academic Press,
New York, pp. 523–547.
Bartolini, G., Prevost, G., Messeri, C., Carignani, G., 1998. Olive Germplasm
Cultivars and World-Wide Collections. FAO seed & Plant Genetic
Resources Service. Plant production and Protection division, Roma.
Besnard, G., Berville, A., 2000. Multiple origins for Mediterranean olive (Olea
europaea L. subsp. europaea) based upon mitochondrial DNA polymorph-
isms. C. R. Acad Sci. Ser. III 323, 173–181.
Besnard, G., Berville, A., 2002. On chloroplast DNA variations in the olive
(Olea europea L.) complex, comparison of RFLP and PCR polymorphisms.
Theor. Appl. Genet. 104, 1157–1163.
Besnard, G., Khadari, B., Villemur, P., Berville, A., 2000. A cytoplasmic male
sterility in olive cultivars (Olea europaea L.): phenotypic, genetic and
molecular approaches. Theor. Appl. Genet 100, 1018–1024.
Besnard, G., Baradat, P., Chevalier, D., Tagmount, A., Berville, A., 2001.
Genetic differentiation in the olive complex (Olea europaea L.) revealed by
RAPDs and RFLPs in the rRNA genes. Genet. Resour. Crop Evol. 48, 165–
182.
Breton, C., Medail, F., Pinatel, C., Berville, A., 2005. Olive—oleaster gene flow
and risks of ferality in olive Chapter 15. In: Gressel, J. (Ed.), Crop Ferality
and Volunteerism, a Threat to Food Security in the Transgenic Era? CRC
Press, Boca Raton, USA, pp. 231–234.
H. Hannachi et al. / Scientia Horticulturae 116 (2008) 280–290290
Breton, C., Besnard, G., Berville, A., 2006a. Using multiple types of molecular
markers to understand olive phylogeography. In: Zeder, M.A., Decker-
Walters, D., Bradley, D., Smith, B. (Eds.), Documenting Domestication,
New Genetic and Archaeological Paradigms. University of California Press,
pp. 142–153.
Breton, C., Tersac, M., Berville, A., 2006b. SSR genetic diversity in wild olive
(oleaster Olea europaea L.) suggests several Plio-Pleistocene refuge zones
in the Mediterranean basin and gene flow with olive. J. Biogeogr. 33, 1916–
1928.
Camps-Fabrer, H. 1953. L’olivier. 1ere partie, In L’olivier et l’huile dans
l’Afrique romaine. Gouvernement general de l’Algerie. Direction de
l’interieur et des beaux arts. Service des Antiquites. Imp. Off., Alger, p.
1–93.
Camps-Fabrer, H. 1997. La culture de l’olivier en Afrique du Nord, Evolution et
histoire. In: Encyclopedie Mondial de l’Olivier, C.O.I. (Eds.), p. 30–33.
Carriero, F., Fontanazza, G., Cellini, F., Giorio, G., 2002. Identification of
simple sequence repeats (SSRs) in olive (Olea europaea L.). Theor. Appl.
Genet. 104, 301–307.
Cipriani, G., Marrazzo, M.T., Marconi, R., Cimato, A., Testolin, R., 2002.
Microsatellite markers isolated in olive are suitable for individual finger-
printing and reveal polymorphism within ancient cultivars Olea europaea L.
Theor. Appl. Genet. 104, 223–228.
Decrully, L., 1907. L’olivier. (Eds.), Masson, Paris, 223 p.
Galili, E., Weinstein-Evron, M., Zohary, D., 1988. Appearance of olives in
submerged Neolithic sites along the Carmel coast. J. Isr. Prehistoric Soc. 22,
95–97.
Gressel, J., 2005. In: Gressel, J. (Ed.), Crop Ferality and Volunteerism. Taylor
and Francis Boca Raton, USA, p. 422.
Hannachi, H., Msallem, M., El Gazzah, M., Ben ELhadj, S., 2006. Etude de la
variabilite pomologique des olives et de la composition en acides gras des
huiles de 15 varietes d’olivier tunisiens (Olea europaea L.). Revue des
Regions Arides 17, 43–64.
Idrissi, A., Ouazzani, N., 2004. Apport des descripteurs morphologiques a
l’inventaire et a l’identification des varietes d’olivier (Olea europaea L.).
IPGR Newslett. 36, 1–10.
Lanfranchi, F, Bui, TM., 1995. Oleastre et lentisque de Corse et de Sardaigne,
deux plantes oleagineuses sauvages dans l’economie Neolithique. In: Olio
Sacro e profano, tradizione olearie in Sardinia e Corsica, M. Atzori and A.
Vodret, Editrice Democratica Sarda, Sassari Italy.
Lumaret, R., Ouazzani, N., 2001. Ancient wild olives in Mediterranean forests.
Nature 413, 700.
Lumaret, R., Ouazzani, N., Michaud, H., Villemur, P., 1997. Cultivated olive
and oleaster, two very closely connected partners of the same species (Olea
europaea). Evidence from enzyme polymorphism. Bocconea 7, 39–42.
Mehri, H., Hellali, R., 1995. Etude pomologique des principales varietes
d’oliviers cultives en Tunisie. Institut de l’olivier Sfax, Tunisie.
Mehri, H., Msallem, M., Kamoun, R., Mehri, R., 1997. Identification des
principaux cultivars d’oliviers cultives en Tunisie. Plant. Genet. Resour.
Newslett. 112, 68–72.
Minangoin N., 1901. L’olivier en Tunisie. Direction de l’agriculture et du
commerce. Imprimerie rapide, Nicolas L., 70 p.
Mtimet, A. 1999. Atlas des sols tunisiens. Ministere de l’Agriculture. Impr.
Graphimed , 165p.
Nei, M., 1972. Genetic distance between populations. Am. Naturalist 106, 283–
292.
Ollivier, D., Artaud, J., Pinatel, C., Durbec, J.P., Guerere, M., 2003. Triacyl-
glycerol and fatty acid compositions of French virgin olive oils. Character-
ization by chemometrics. J. Agric. Food Chem. 51 (19), 5723–5731.
Reagon, M., Snow, A.A., 2006. Cultivated Helianthus annuus (Asteraceae)
volunteers as a genetic ‘‘bridge’’ to weedy sunflower populations in north
America. Am. J. Bot. 93 (1), 127–133.
Rotondi, A., Magli, M., Ricciolini, C., Baldoni, L., 2003. Morphological and
molecular analyses for the characterization of a group of Italian olive
cultivars. Euphytica 132, 129–137.
Santoni, S., Berville, A., 1992. Evidences for gene exchanges between sugar
beet (B. vulgaris L.) and wild beets, consequence for transgenic sugar beets.
Plant Mol. Biol. 20, 578–580.
Sefc, K.M., Lopes, M.S., Mendonca, D., Dos Santos, M.R., Da Camara
Machado, M.L., Da Camara Machado, A., 2000. Identification of micro-
satellite loci in olive (Olea europaea) and their characterization in Italian
and Iberian olive trees. Mol. Ecol. 9, 1171–1173.
Terral, J.F., 1997a. La domestication de l’olivier (Olea europaea L.) en
Mediterranee nord occidentale. Approche morphometrique et implications
paleoclimatiques. Thesis. Montpellier II.
Terral, J.F., 1997b. Debuts de la domestication de l’olivier (Olea europaea L.)
en Mediterranee nord-occidentale, mise en evidence par l’analyse morpho-
metrique appliquee a du materiel anthracologique. C. R. Acad. Sci. Paris,
Ser. IIa 324, 417–425.
Terral, J.F., 2000. Exploitation and management of the olive tree during
Prehistoric times in Mediterranean France and Spain. J. Archaeol. Sci.
27, 127–133.
Terral, J.F., Arnold-Simard, G., 1996. Beginnings of olive cultivation in eastern
Spain in relation to Holocene bioclimatic changes. Quaternary Res. 46,
176–185.
Terral, J.F., Alonso, N., Buxo, R., Capdevila, I., Chatti, N., Fabre, L., Fiorentino,
G., Marinval, P., Perez Jorda, G., Pradat, B., Rovira, N., Alibert, P., 2004.
Historical biogeography of olive domestication (Olea europaea L.) as
revealed by geometrical morphometry applied to biological and archae-
ological material. J. Biogeogr. 31, 63–77.
Trigui, A., Msallem, M., 2002. Oliviers de Tunisie , In: Catalogue des varietes
autochtones & types locaux, identification varietale & caracterisation
morpho-pomologique des ressources genetiques oleicoles de Tunisie vol.
1. (Fr) Ministere de l’Agriculture, IRESA, Institut de l’Olivier, [S.l.],
Tunisia.
Valdeyron, G., Crossa-Raynaud, P., 1950. Les fruits de Tunisie, Annales de
services Botanique et Agronomique de Tunisie, pp. 23–44.
Viard, F., Arnaud, J.-F., Delescluse, M., Cuguen, J., 2004. Tracing back seed and
pollen flow within the crop-wild Beta vulgaris complex, genetic distinc-
tiveness vs. hot spots of hybridization over a regional scale. Mol. Ecol. 13,
1357–1364.
Vorbeck, M.L., Marinetti, G.V., 1965. Separation of glycosyl diglycerides from
phosphatides using silicic acid column chromatography. J. Lipids Res. 6, 3–
6.
Ward Jr., J.H., 1963. Hierarchical grouping to optimize an objective function. J.
Am. Stat. Assoc. 58, 236–244.
Whitton, J., Wolf, D.E., Arias, D.M., Snow, A.A., Rieseberg, L.H., 1997. The
persistence of cultivar alleles in wild populations of sunflowers five gen-
erations after hybridization. Theor. Appl. Genet. 95, 33–40.
Zohary, D., Spiegel Roy, P., 1975. Beginnings of fruit growing in the old world.
Science 187, 319–327.