BMPER Is an Endothelial Cell Regulator and Controls Bone Morphogenetic Protein-4-Dependent...

BMPER Is an Endothelial Cell Regulator and Controls BoneMorphogenetic Protein-4–Dependent Angiogenesis

Jennifer Heinke, Leonie Wehofsits, Qian Zhou, Christoph Zoeller, Kim-Miriam Baar, Thomas Helbing,Anna Laib, Hellmut Augustin, Christoph Bode, Cam Patterson, Martin Moser

Abstract—Bone morphogenetic proteins (BMPs) are involved in embryonic and adult blood vessel formation in health anddisease. BMPER (BMP endothelial cell precursor–derived regulator) is a differentially expressed protein in embryonicendothelial precursor cells. In earlier work, we found that BMPER interacts with BMPs and when overexpressedantagonizes their function in embryonic axis formation. In contrast, in a BMPER-deficient zebrafish model, BMPERbehaves as a BMP agonist. Furthermore, lack of BMPER induces a vascular phenotype in zebrafish that is driven bydisarray of the intersomitic vasculature. Here, we investigate the impact of BMPER on endothelial cell function andsignaling and elucidate its role in BMP-4 function in gain- and loss-of-function models. As shown by Western blottingand immunocytochemistry, BMPER is an extracellular matrix protein expressed by endothelial cells in skin, heart, andlung. We show that BMPER is a downstream target of FoxO3a and consistently exerts activating effects on endothelialcell sprouting and migration in vitro and in vivo. Accordingly, when BMPER is depleted from endothelial cells,sprouting is impaired. In terms of BMPER related intracellular signaling, we show that BMPER is permissive andnecessary for Smad 1/5 phosphorylation and induces Erk1/2 activation. Most interestingly, BMPER is necessary forBMP-4 to exert its activating role in endothelial function and to induce Smad 1/5 activation. Vice versa, BMP-4 isnecessary for BMPER activity. Taken together, BMPER is a dose-dependent endothelial cell activator that plays aunique and pivotal role in fine-tuning BMP activity in angiogenesis. (Circ Res. 2008;103:804-812.)

Key Words: BMPER � bone morphogenetic proteins � vascular biology � endothelial cell function � signaling

Angiogenesis is a basic biological event that is involved inembryonic development but also in adult physiological

and pathological conditions, such as inflammation, tumorgrowth, atherosclerosis, or response to ischemia. This processdepends on the orchestrated function of intra- and extracel-lular proteins, many of which are conserved from embryonicdevelopment through adulthood.1

Bone morphogenetic proteins (BMPs) are members of thetransforming growth factor (TGF)-� superfamily. Originally,they have been identified by their ability to induce ectopicbone formation and have been extensively studied duringembryonic development, in which they control axis formationand organogenesis. Today, more than 20 BMP-related pro-teins and a number of BMP modulating proteins have beenidentified.2 A growing body of evidence suggests that theyserve as important regulators in vascular development anddisease.3 BMPs are extracellular proteins that signal throughcell surface complexes of type I and type II serine/threoninekinase receptors. On activation, the receptors mediate intra-cellular signaling mainly through the Smad 1/5 transcription

factors. BMP signaling is regulated at several levels: activityof R-Smads (1/5) is modulated by facilitating (eg, Smad 4) orinhibitory (eg, Smad 6) co-Smads.4 BMP receptors undergoregulation by clustering, and last, but not least, extracellularagonists such as BMP-4 are modulated in their function byextracellular binding proteins such as chordin,5 chordin-like 2(CHL-2),6 noggin,7 drm/gremlin,8 twisted gastrulation (Tsg),9

and BMPER.10,11

BMPER was originally identified in a screen for differen-tially expressed proteins in embryonic endothelial precursorcells.10 BMPER is a secreted glycoprotein that contains 5cysteine-rich domains, followed by a von Willebrand Ddomain and a trypsin inhibitor domain, and is, thus, thevertebrate homolog of drosophila crossveinless-2. BMPERbinds directly to BMPs and modulates their function. So far,inconclusive data have been reported about BMPER and itsmodulating function on BMP-4. In gain-of-function assaysanti-BMP activity of BMPER has been reported,10,12

whereas in loss-of-function models BMPER exerts pro-BMP functions.13–16

Original received December 10, 2007; resubmission received April 29, 2008; revised resubmission received August 11, 2008; accepted September 3,2008.

From the Departments of Cardiology (J.H., L.W., Q.Z., C.Z., K.-M.B., T.H., C.B., M.M.) and Biology (J.H., K.-M.B.), University of Freiburg,Germany; German Center for Cancer Research (A.L., H.A.), Heidelberg, Germany; and Carolina Cardiovascular Biology Center (C.P.), University ofNorth Carolina, Chapel Hill.

Correspondence to Martin Moser, University of Freiburg, Department of Cardiology, Hugstetter Strasse 55, 79106 Freiburg, Germany. [email protected]

© 2008 American Heart Association, Inc.

Circulation Research is available at http://circres.ahajournals.org DOI: 10.1161/CIRCRESAHA.108.178434

804 by guest on July 17, 2015http://circres.ahajournals.org/Downloaded from by guest on July 17, 2015http://circres.ahajournals.org/Downloaded from by guest on July 17, 2015http://circres.ahajournals.org/Downloaded from by guest on July 17, 2015http://circres.ahajournals.org/Downloaded from by guest on July 17, 2015http://circres.ahajournals.org/Downloaded from by guest on July 17, 2015http://circres.ahajournals.org/Downloaded from by guest on July 17, 2015http://circres.ahajournals.org/Downloaded from by guest on July 17, 2015http://circres.ahajournals.org/Downloaded from by guest on July 17, 2015http://circres.ahajournals.org/Downloaded from by guest on July 17, 2015http://circres.ahajournals.org/Downloaded from

http://circres.ahajournals.org/










Based on our findings in zebrafish, where loss of BMPERfunction results in a disarray of intersomitic blood vessels,13

here, we study the function of BMPER in endothelial cellbiology and angiogenesis. Our data indicate that BMPER isnecessary for endothelial cell sprouting and has a dose-dependent stimulating effect on sprouting and migration. Toachieve these effects, both BMPER and BMP-4 are depen-dent on the presence of one another. We further show thatBMPER is involved in Smad 1/5 and Erk1/2 signaling. Inconclusion, BMPER has proangiogenic properties by modu-lating BMP-4 signaling.

Materials and MethodsCell culture, immunocytochemistry, flow cytometry, adhesion assay,real-time PCR, Western blot analysis, human umbilical vein endo-thelial cell (HUVEC) transfection, chick chorioallantois membrane

(CAM) assay, primer sequences, reagents, and antibodies are de-scribed in the online data supplement, available at http://circres.ahajournals.org.

RNA InterferenceBMPER small interfering (si)RNAs were purchased from Ambion.BMP-4 and FoxO3a siRNAs were purchased from Invitrogen.Scrambled negative control Alexa Fluor 488 nm was purchased fromQiagen. The specific sequences are given in the online data supple-ment. For siRNA transfection, Lipofectamine RNAiMAX was usedaccording to the protocol of the manufacturer (Invitrogen). Trans-fection efficiency was confirmed by quantitative real-time (quanti-tative) PCR. Functional cell culture assays were performed between8 to 48 hours posttransfection.

Matrigel Sprouting AssayCulture plates were coated with Matrigel (BD Biosciences) accord-ing to the instructions of the manufacturer. HUVECs were pretreatedwith basic fibroblast growth factor (40 ng/mL), BMP-4 (25 ng/mL),Noggin (100 ng/mL), or various concentrations of BMPER (allR&D) in 1% FBS/EBM for 16 to 18 hours. A total of 3�104 cellswere cultured on Matrigel for 3 hours at 37°C. Cells were fixed with4% paraformaldehyde and pictures were taken from 4 randommicroscopic fields. The cumulative sprout length and the number ofbranch points were quantified as described for the spheroid assay.

HUVEC Spheroid Sprouting AssayHUVEC spheroids were generated as previously described.17

Briefly, HUVECs were grown as hanging drops of approximately625 cells each for 24 hours in a cell culture incubator. For gelpreparation spheroids were resuspended in carboxymethylcellulosecontaining 20% FBS, mixed with the same volume of collagen,adjusted to pH 7.4, rapidly aliquoted into a 24-well plate andincubated for 1 hour at 37°C for polymerization before sprouting wasstimulated with 100 �L 0.5% BSA or growth factors in EBM for 24hours in triplicates. To quantify in-gel angiogenesis the cumulativelength of all capillary-like sprouts originating from the core of anindividual spheroid was measured at 5x magnification using adigitized imaging system. At least 10 spheroids per condition wereanalyzed with AxioVision Rel. 4.6.

Figure 1. BMPER expression, localization, and regulation byFoxO3a in endothelial cells. A, Expression of BMPER in humanvascular endothelial cells of different origin. Cells were lysed andsubjected to Western blot analysis with the indicated antibodies.B and C, Localization of BMPER was characterized by immuno-cytochemistry in C166 mouse yolk sac endothelial cells. Corre-sponding serum was used as negative control. Nuclei werestained with DAPI. Scale bar�100 �m. D and E, Silencing ofFoxO3a in HUVECs with 2 different siRNAs compared to scram-bled siRNA control resulted in enhanced BMPER expressionshown by RT-PCR (D) and Western blot analysis (E). Seventy-two hours after transfection, mRNA expression was analyzed byusing specific primers for FoxO3a, BMPER, and human RNApolymerase II. Western blot analysis was performed with theindicated antibodies. �-Tubulin served as loading control. Rep-resentative Western blots are shown, along with densitometricanalysis of the time course of BMPER expression. F, BMPERmRNA expression at 72 and 96 hours after transfection withFoxO3awt or the constitutively active mutant FoxO3aA3 com-pared to empty vector. BMPER mRNA was quantified by real-time (quantitative) PCR using specific primers for BMPER andhRP as internal control. BMPER mRNA expression was calcu-lated using the ��CT method. Means�SD. *P�0.05 vs control.

CCon

tBMPER I

BMPER II

BMPER

Tubulin

siRNA

B

hRP

BMPER

Cont

BMPER I

BMPER II

siRNA

*

A100

75

0

25

50

mR

NA

expr

essi

on [%

] vs.

Con

t

* *

*

BMPER I

BMPER IICon

t

BMPER I

BMPER IIsiRNA

24h 48h

Figure 2. Specific silencingof BMPER by siRNA inHUVECs. A, BMPERmRNA expression after24 and 48 hours posttrans-fection with the siRNA

BMPER I and II, respectively, compared to scrambled siRNAcontrol. BMPER mRNA was quantified by real-time (quantitative)PCR using specific primers for BMPER and human RNA poly-merase II as internal control. Knockdown efficiency was calcu-lated using ��CT method. Means�SD; n�4. *P�0.001 vs con-trol. B, Representative semiquantitative RT-PCR analysis 24hours posttransfection is shown. C, Western blot analysis wasperformed with the indicated antibodies 48 hoursposttransfection.

Heinke et al BMPER Activates Angiogenesis and Controls BMP-4 805

by guest on July 17, 2015http://circres.ahajournals.org/Downloaded from


Migration AssayTo determine the migration of endothelial cells, HUVECs werelabeled with 10 �mol/L CFDA-SE (Invitrogen) in PBS, detachedwith trypsin/Versene, harvested by centrifugation, resuspended inEBM with 0.5% BSA, counted and placed in the upper chamber ofa modified Boyden chamber (1x105 cells per HTS FluoroBlok24-well chamber; pore size 8 �m; BD Biosciences). The chamberswere placed in 24-well culture dishes containing EBM with 0.5%BSA or growth factors. After incubation for 4 hours at 37°C, 5% CO2

the cells were fixed with 4% paraformaldehyde and migrated cellswere counted manually in 5 random microscopic fields using afluorescent microscope.

Matrigel Plug Assay and ImmunohistochemistryGrowth factor–reduced Matrigel (BD Biosciences) was thawedovernight at 4°C and mixed with heparin to a final concentration of20 U/mL. BMPER was added to final concentrations of 20 up to5000 ng/mL to a total volume of 500 �L of Matrigel. Basic fibroblastgrowth factor (150 ng/mL) was used as a positive control. Matrigelcontaining the respective growth factors or vehicle was injectedsubcutaneously in to the groins of female C57BL/6 mice (TheJackson Laboratory). After 9 days, plugs were isolated, fixed in 4%paraformaldehyde, and sectioned. For immunofluorescence staining,slides were blocked with 10% normal goat serum and incubatedovernight with polyclonal primary antibody (anti-CD31) and sec-ondary fluorescent antibody Cy-3. Blood vessel infiltration wasanalyzed in 10 random hematotoxin/eosin-stained sections analyzedwith Zeiss Axioplan2/Axiovision (version 4.6). Experiments wereperformed according to the Animals Scientific Procedures Act of1986 and local ethics protocols.

Statistical Analysis and QuantificationStatistical analysis was performed using GraphPad Prism 4.0. Dataare presented as means�SD, and comparisons were calculated byStudent’s t test (2-sided, unpaired). Results were considered statis-tically significant when P�0.05. Densitometric analysis of Westernblots was performed using Quantity One 1-D Analysis Software(version 4.4, Bio-Rad).

ResultsBMPER Expression in Endothelial CellsBased on our previous work, we hypothesized that BMPER maybe expressed by mature endothelial cells. Indeed, BMPER wasdetectable in venous endothelial cells (HUVECs), as well asin human microvascular endothelial cells obtained from skin,heart, and lung (Figure 1A). BMPER is expressed in theextracellular space and at the surface of culture yolk sacendothelial cells as demonstrated by immunocytochemistry(Figure 1B). These data, taken together with our previousfindings,10 indicate that BMPER is an extracellular proteinexpressed by endothelial cells.

BMPER Regulation by FoxO3aFoxO transcription factors have been implicated in BMPERregulation in a mouse model lacking all 3 FoxOs. To testwhether FoxO transcription factors regulate BMPER also inendothelial cells, we silenced FoxO3a using 2 differentsiRNAs in HUVECs. Indeed, BMPER RNA and protein wasupregulated when FoxO3a was silenced (Figure 1D and 1E),

Figure 3. BMPER regulates endothelial cell sprouting. Serum-starved HUVECs were treated with or without BMPER at indi-cated concentrations or basic fibroblast growth factor (bFGF)(40 ng/mL) as a positive control for 16 to 18 hours before theywere seeded onto Matrigel. A through C, Representative micro-graphs are shown. Scale bar�200 �m. D and F, Cumulativesprout length of capillary-like structures were measured after 3hours. E and G, The number of branch points was counted inthe same specimens as used for D and F. *P�0.05 vs control.F and G, HUVECs were transfected with either of 2 BMPER-specific siRNAs or scrambled siRNA control. Forty-eight hoursposttransfection, the Matrigel assay was performed. Recombi-nant BMPER protein was added to the BMPER-depleted cells to

Figure 3 (Continued). demonstrate specific rescue of the siRNAeffect. Cumulative sprout length and branch points of capillary-like structures were measured. Means�SD. D through G showthe result of 1 of 3 independent experiments. *P�0.05 vs con-trol; #P�0.01 vs siRNA alone.

806 Circulation Research October 10, 2008



suggesting that BMPER is a downstream target of FoxO3a.Accordingly, overexpression of a constitutively active variantof FoxO3a resulted in downregulation of BMPER mRNA(Figure 1F), indicating that FoxO3a is a suppressor ofBMPER expression.

BMPER Effect on Endothelial Cell SproutingThe function of BMPER in endothelial cells was investigatedin gain- and loss-of-function models. Silencing of BMPERwas effectively achieved at 24 and 48 hours after siRNAtransfection, as determined by RT-PCR and Western blotanalysis (Figure 2A through 2C). BMPER effect on endothe-lial cell sprouting was studied in the Matrigel tube-formingassay (Figure 3) and the HUVEC spheroid-sprouting assayproviding collagen instead of Matrigel in a 3D matrix (Figure4). In the Matrigel tube-forming assay, HUVEC sproutingwas enhanced by up to 53% when BMPER was added atconcentrations from 5 to 30 ng/mL, as quantified by assess-ment of total sprout length or the number of branch points(Figure 3A, 3B, 3D, and 3E). At high BMPER concentra-tions, HUVEC sprouting was less and less pronounced. WhenBMPER was depleted from HUVECs, cell sprouting andbranching were inhibited, consistent with an activating rolefor BMPER at lower concentrations (Figure 3F and 3G). Thiseffect could be rescued by adding BMPER to siBMPERsilenced cells (Figure 3F and 3G). In the HUVEC spheroid-sprouting assay, we obtained very similar results. LowBMPER concentrations resulted in enhanced sprouting,whereas higher BMPER concentrations prevent the activationof HUVEC sprouting (Figure 4 through 4C). Taken together,these data indicate that BMPER is necessary for endothelialcell sprouting and that, independent from the assay systemused, low BMPER concentrations enhance sprouting,whereas at higher concentrations endothelial cell sprouting isprevented.

BMPER Effect on Endothelial Cell MigrationTo investigate the effect of BMPER on endothelial cellmigration, we used a modified Boyden chamber system.Similar to the effects on endothelial cell sprouting, BMPERstimulated HUVECs to migrate faster at low concentrations,whereas migration is prevented at higher BMPER concentra-tions (Figure 4D). Thus, BMPER not only enhances endothe-lial cell sprouting but also stimulates endothelial cell migra-tion in a dose-dependent manner.

BMPER Increases Capillary NetworkDensity in the CAMTo investigate BMPER function in vivo, we performed theCAM assay in chick embryos. BMPER protein was applied tothe CAM and differentiation of the chorionic capillary net-work was visualized by staining endothelial cells (Figure 5).The capillary network was denser, and the diameter of thecapillaries was greater in the presence of BMPER, verysimilar to the effect obtained by addition of VEGF, indicatingthat endothelial cells are stimulated by BMPER. Consistentwith our in vitro findings, high BMPER doses preventendothelial cell activation in the CAM. Thus, these in vivo

findings are consistent with increased endothelial cell migra-tion and sprouting induced by BMPER observed in vitro.

BMPER Induces Angiogenesis in theIn Vivo Matrigel Plug AssayAs a second in vivo model, we used the mouse subcutaneousMatrigel plug assay to investigate angiogenic activity ofBMPER. Consistent with our observations in the CAM, we

A

*

80

*

60

*

***

Spr

out L

engt

h [µ

m]

VEGF 10 5 40 20 BMPER [ng/ml]

Cont

1500

0

500

1000

1250

250

750

1750

*

BCont BMPER 60 ng/ml C

D

Mig

rate

d C

ells

/hpf

*

**

60

50

40

30

20

10

0VEGF 50 25 150 100 75

BMPER [ng/ml]

Cont 125

Figure 4. BMPER regulates HUVEC spheroid sprouting and en-dothelial cell migration. A through C, HUVEC spheroids wereembedded in collagen gel and stimulated for 24 hours with orwithout BMPER in indicated concentrations or VEGF (5 ng/mLfinal concentration) as positive control. A, Quantitative analysisof cumulative sprout length of spheroids is shown. Means�SD;n�5. *P�0.001 vs control. Representative spheroids incubatedwithout (B) or with BMPER (C) are shown. Scale bar�200 �m.D, Endothelial cells were serum-starved overnight, and transmi-gration assay was performed with or without BMPER at indi-cated concentrations or VEGF (100 ng/mL final concentration)as positive control. Triplicates were fixed after 4 hours, and foreach, 5 random microscopic fields were counted. Means�SD; 4independent experiments were performed in triplicates. *P�0.05vs control. hpf indicates high-power field




found that increasing concentrations of BMPER enhanced theinvasion of endothelial cells into the Matrigel plug in adose-dependent manner (Figure 5B through 5D), but highBMPER doses prevented endothelial cell invasion. Thesedata confirm in vivo that BMPER exerts proangiogeniccharacteristics.

BMPER Effect on Endothelial Cell AdhesionEndothelial cell adhesion was examined in vitro by exposingHUVECs to protein matrices in the presence or absence ofBMPER (Figure 6A). As expected, HUVECs adhered todifferent matrices but BMPER had no additional effect onendothelial cell adhesion. These data indicate that BMPERsignaling is not involved in the initiation of endothelial celladhesion. Nonetheless, we hypothesized that the quality ofadhesion may be modulated by BMPER because BMPERinduces endothelial cell sprouting and migration. Cell sprout-ing and migration is preceded by an “intermediate state ofadhesion,” allowing for cell movement. To investigate adhe-sion in more detail, we visualized changes in cytoskeletonorganization by fluorescent staining using phalloidin. Indeed,actin fibers change their confirmation, and cells seem topartially detach from the underlying matrix in a controlledmanner, as suggested by the ring-shaped organization of actinfibers when BMPER is added (Figure 6B and 6C).

BMPER Effect on Apoptosis andIntracellular SignalingBecause we have observed the reversal of endothelial cellsprouting and migration at high BMPER doses, we askedwhether apoptosis was involved. Therefore, we performed theannexin V assay on HUVECs incubated with increasing

doses of BMPER (Figure 7A). Using staurosporine as apositive control, we did not observe apoptosis even at highBMPER concentrations, suggesting that apoptosis is notinvolved in the reversal of the BMPER effect at higherconcentrations.

To investigate the signaling pathways involved in BMPERsignaling in endothelial cells, we analyzed the Erk cascadeand the Smad pathway, because both have been implicated inendothelial cell sprouting and migration (Figure 7B through7D). Indeed, increasing amounts of BMPER resulted inincreased Erk1/2 phosphorylation. In contrast, Smad 1/5phosphorylation was enhanced at low BMPER concentrationsand remained unchanged when the BMPER concentrationwas increased. In time course experiments, both Smad 1/5and Erk1/2 phosphorylation reached a maximum at 20 min-utes of BMPER exposure. Consistently, when BMPER wassilenced, Erk1/2 and Smad 1/5 phosphorylation were blocked(Figure 7D). These data implicate that BMPER activates theErk pathway and is permissive for Smad 1/5 phosphorylation.

BMPER Controls BMP-4 Function inEndothelial CellsPrevious work from our group indicates that BMPER inter-acts directly with BMP-4 and modulates its function. Toassess whether BMPER is necessary for BMP-4 signaling, weanalyzed Smad 1/5 phosphorylation and performed functionalassays. BMP-4 induces phosphorylation of Smad 1/5 as areadout of the BMP pathway activity (Figure 8A). WhenBMPER was silenced, BMP-4 partly lost its ability to activateSmad 1/5. This signaling defect translated into an inhibitionof functional BMP-4 response in endothelial cell sproutingand migration when BMPER was silenced (Figure 8B and

A BCont bFGF BMPER

C BMPERD

bFGF 500 100 20 BMPER [ng/ml]

ContN

umbe

r of v

esse

ls0

200

400

500

100

300

***

2500 5000

Cont

BMPER 100ng

VEGF

BMPER 500ng

Figure 5. BMPER stimulates angiogenesis in vivo. A, En face views of chick CAMs. On embryonic day 9, BMPER was applied to theCAM within a plastic ring to mark the application site. After 4 days, the CAM was harvested, fixed, and stained for endothelium (red).Intercapillary pillars remain unstained (black). Note the increased capillary density (red capillary network) in CAM stimulated with 100ng/mL VEGF and BMPER compared to control and CAM stimulated with higher concentrations of BMPER (500 ng/mL). Scale bar�50 �m. B and C, Matrigel plug assay in mouse. Matrigel containing indicated proteins was injected subcutaneously into C57BL/6 mice.Matrigel plugs were harvested 9 days after implantation, fixed, sectioned, and stained. B, Representative micrographs of Matrigel plugsstained with hematotoxin/eosin. C, Quantification of B. *P�0.0001 vs control. D, Representative micrograph of a BMPER Matrigel plugstained with CD31-Cy3 (red). Nuclei were stained with DAPI (blue). Scale bar�200 �m.




8C). These data indicate that BMPER is necessary for BMP-4to exert its function.

BMPER Is Dependent on BMP-4 toExert Its FunctionBecause we have shown that BMP-4 signaling is dependenton BMPER, we asked whether, vice versa, BMPER wasdependent on BMP-4 to stimulate angiogenesis. To blockBMP-4 activity, we used either 2 BMP-4–specific siRNAs orthe natural BMP antagonists noggin or chordin (Figure 8Dthrough 8G and Figure I in the online data supplement).Indeed, when BMP-4 was absent or blocked, HUVEC did notsprout in response to BMPER stimulation. These observa-tions suggest that BMP-4 is necessary for BMPER to exert itsangiogenic activity.

DiscussionHere, we provide the first characterization of BMPER inendothelial cell biology. The data presented here indicate thatBMPER controls BMP-4 activity and, vice versa, is depen-dent on BMP-4 to exert angiogenic activity in vascularendothelial cells.

BMPER Expression and Vascular PhenotypeOur data clearly confirm previous observations and in silicioprediction that BMPER is expressed by endothelial cells as anextracellular protein, strongly supporting the notion thatBMPER is present in the extracellular matrix. This is ofimportance because most BMP family members and theirantagonists such as chordin and noggin, as potential BMPER-interacting partners, can also be found in the extracellularmatrix.18

Consistent with our differential screening strategy bywhich BMPER was identified in embryonic endothelialprecursor cells,10 here, we present evidence that BMPER isexpressed by endothelial cells of various origins, includingvenous and microvascular endothelial cells, as well as em-bryonic yolk sac endothelial cells (Figure 1). In earlier work,we found that BMPER is upregulated at the time of vascu-logenesis in parallel to flk-1 in differentiating mouse embry-oid bodies.10 Along the same line of evidence, BMPER isregulated in animal models displaying vascular phenotypes.

Mice lacking all 3 members of the FoxO family oftranscription factors develop hemangiomas or even lethalangiosarcomas.19 Interestingly, in these mice, BMPER,among other proteins, is among the most upregulated genes,suggesting, on one hand, a role for FoxO transcription factorsin BMPER regulation and, on the other hand, a role forBMPER in the development of hemangiomas. In particular,FoxO3 has been implicated to be important in endothelial cellregulation.20 Depletion of FoxO3a from HUVECs is followedby enhanced sprouting and migration. In our experiments,depletion of FoxO3a from HUVECs led to upregulation ofBMPER and overexpression of constitutively active FoxO3ato downregulation of BMPER (Figure 1), confirming thatBMPER is a downstream target of FoxO3 in endothelial cells.Moreover, findings reported here suggest that BMPER maybe the missing link to explain the effects of FoxO3a onendothelial cell function.

The most striking evidence that BMPER is involved inblood vessel formation and endothelial cell biology comesfrom our earlier work in zebrafish.13 In these experiments,BMPER is expressed at sites and at the time of vasculogen-esis. Even more interesting, knock down of BMPER inzebrafish results in a vascular phenotype mainly driven bydisturbed intersomitic blood vessel patterning. Therefore, wehypothesize that BMPER plays an important role in endothe-lial cell migration and sprouting.

BMPER Promotes AngiogenesisFirst, we addressed the question of whether BMPER has aninfluence on endothelial cell sprouting. In the in vitro Matri-gel sprouting assay, increasing concentrations of BMPERinduced HUVEC sprouting, consistent with an activatingrole of BMPER (Figure 3). This finding holds true for bothtotal sprout length and number of branch points. Similarly,BMPER induced sprouting in the 3D HUVEC spheroid assayproviding collagen instead of Matrigel as a substrate (Figure4). Consistent with an activating effect of BMPER, sproutingof HUVECs was significantly inhibited when BMPER wassilenced in the Matrigel assay (Figure 3). Angiogenesis is notonly dependent on endothelial cell sprouting but also on cell

A

BMPER

OD

405

nm

0.0

0.7

0.6

0.5

0.4

0.3

0.2

0.1

0.8

BSA VtnFbnFib GelCol- -+-+-+-+-+ +

Cont B BMPER C

0.9

Figure 6. BMPER affects endothelial cell adhesion. A, HUVECswere incubated with or without BMPER on different proteinmatrices. After 1 hour, cells were permeabilized and activity ofcytosolic phosphatase was measured using a spectrometer.Quantitative analysis of 4 independent experiments is shown.Means�SD (B and C). Adhesion of HUVECs on fibronectinmatrix incubated for 24 hours with BMPER (20 ng/mL) (C) orBSA as control (B) was visualized by staining actin fibers withphalloidin-TRITC (red). Representative cells are shown. Note thering-shaped arrangement of actin fibers following the edges ofthe cell in BMPER-treated cells. Col indicates collagen; Fib,fibrinogen; Fbn, fibronectin; Gel, gelatin; Vtn, vitronectin. Scalebar�50 �m.




migration. Indeed, BMPER induces endothelial cell migra-tion in vitro (Figure 4). In the in vivo CAM assay, which hasbeen used before to characterize BMP pathway members,8 weobserved enhanced endothelial cell activity in the chorioniccapillary network when BMPER was added (Figure 5). As asecond in vivo assay, we performed the subcutaneous Matri-gel plug assay in mouse and also found increasing endothelialcell invasion induced by BMPER, confirming our in vitro andthe CAM data. Obviously, in order for endothelial cells toproceed along the angiogenetic pathway, sprouting and mi-gration has to be activated. However, at the same time, cellsmust detach in a controlled manner from the underlyingmatrix to allow for dislocation of the cell.1,21,22 Consistentwith an activating role of BMPER on angiogenesis, endothe-lial cell adhesion was not increased, but cell motility wasfacilitated when BMPER was present (Figure 6). Interest-ingly, endothelial cell activity was prevented at higher BM-PER concentrations in vitro and in vivo, suggesting a com-plex mechanism of regulation of angiogenesis by BMPER.Taken together, these findings support the notion that BM-PER has proangiogenic capacity and modulates endothelialcell function in a concentration-dependent manner.

BMPER and BMP-4 Interact FunctionallyEarlier work by us and others has demonstrated that BMPERinteracts directly with BMP-4.10,12 Furthermore, BMPER andBMP-4 are at least partly coexpressed during embryonicdevelopment, as well as in adult organisms, and, in terms ofangiogenesis, BMP-4 has reportedly very similar effects onendothelial cells compared with what we found for BM-PER.17,23,24 We were interested to know whether BMPER andBMP-4 may act independently or whether they are dependenton the presence of one another. In loss-of-function experi-ments for BMPER, we found that BMP-4 cannot exert itsproangiogenic response without BMPER. Vice versa, whenBMP-4 was absent or blocked, endothelial cells were resistantto stimulation by BMPER (Figure 8). These observationsindicate that both BMPER and BMP-4 are needed to create apro-BMP signal in endothelial cells. During the preparationof this manuscript, the BMPER homolog crossveinless-2 hasrecently been shown in Drosophila to be a concentration-dependent regulator of BMP signaling, which is in line withour findings for the role of BMPER in endothelial cellactivation.25

To shed light on the downstream signaling events inducedby BMP-4 and BMPER stimulation, we have analyzed Smad1/5 and Erk1/2 signaling, because these cascades are involvedin BMP signaling.17 Indeed, we found dose-dependent phos-phorylation of Erk1/2, with increasing doses of BMPER(Figure 7). Quite differently, BMPER was permissive forSmad 1/5 phosphorylation but had no dose-dependent stim-ulatory effect, suggesting that the negative regulation ofangiogenesis observed at higher BMPER doses is indepen-

Figure 7. BMPER induces intracellular signaling. A, Apoptosisassay. HUVECs were incubated for 24 hours without or withindicated BMPER concentrations or with staurosporine for 4hours as positive control. Apoptosis was quantified by flowcytometry. A representative histogram of 1 of 3 independentexperiments with similar results is shown. B and C, Dose andtime dependence of intracellular signaling by BMPER inHUVECs. Western blot analyses were performed with the indi-cated antibodies. Representative Western blots of 1 of 4 inde-pendent experiments are shown, along with a densitometricanalysis of the time course for Erk1/2 phosphorylation.

Figure 7 (Continued). Means�SD. *P�0.05 vs control. D,HUVECs were transfected with either of 2 BMPER-specific siR-NAs or scrambled control. After 48 hours, cells were lysed andsubjected to Western blot analysis performed with the indicatedantibodies.




dent of Smad 1/5. Notably, when BMPER is depleted fromHUVECs, both Smad 1/5 and Erk1/2 phosphorylation areabolished. Thus, BMPER is involved in both pathways. Itseffect on Smad phosphorylation is most likely related to

BMP-4, whereas the dose-dependent Erk activation inducedby BMPER may also be a BMP-independent effect.

Model of BMPER–BMP-4 InteractionWe have observed that the effect of BMPER is reversed athigh concentrations. Similar results have been obtained byothers for BMP-4. These investigators found that apoptosiswas involved in the reversal of BMP-4 effects.26 In contrast,high concentrations of BMPER do not induce apoptosis (Figure7). Taking into consideration these data and the controversialresults that have been reported about BMPER function inembryogenesis, here, we propose a model for BMPER andBMP4 interaction (supplemental Figure II)10,12–16: BMPERsupports a positive-feedback loop for BMP signals by pres-enting BMP-4 to its receptor. This effect helps to accumulateBMP-4 activity, as deducted from observations in Drosoph-ila, in which the BMPER homolog crossveinless-2 contrib-utes to BMP gradient formation and sharpening.27–29 Wheneither BMPER or BMPs are absent, pro-BMP signaling isinhibited and cellular function is impaired. Binding affinity ofBMPs to BMPER equals the binding affinity of BMPs to theirreceptors.29 This may contribute to the net anti-BMP effect ofBMPER at high concentrations, because BMPs then bindpreferentially to BMPER and are not available for receptorbinding.

In summary, functional BMPER experiments reveal an im-portant concentration-dependent role of BMPER in controllingBMP-4 activity in vascular endothelial cells and, thereby,regulation of angiogenesis. In this context, BMPER is uniquein terms of its dose-dependent pro– or anti–BMP-4 capacity,which contributes to locally fine-tuning BMP activity.

AcknowledgmentsWe thank Bianca Engert and Ute Wering for excellent technicalassistance. Philipp Esser provided expertise in confocal micros-copy. We are grateful to Wolfgang Driever for critically readingthe manuscript.

Sources of FundingWork in the laboratories of M.M. and H.A. is supported by DeutscheForschungsgemeinschaft grant SFB-TR23 (A1).

DisclosuresNone.

References1. Carmeliet P. Mechanisms of angiogenesis and arteriogenesis. Nat

Med. 2000;6:389–395.2. Moser M, Patterson C. Bone morphogenetic proteins and vascular dif-

ferentiation: BMPing up vasculogenesis. Thromb Haemost. 2005;94:713–718.

3. ten Dijke P, Arthur HM. Extracellular control of TGFbeta signalling invascular development and disease. Nat Rev Mol Cell Biol. 2007;8:857–869.

4. Schmierer B, Hill CS. TGFbeta-SMAD signal transduction: molecularspecificity and functional flexibility. Nat Rev Mol Cell Biol. 2007;8:970–982.

5. Piccolo S, Sasai Y, Lu B, De Robertis EM. Dorsoventral patterning inXenopus: inhibition of ventral signals by direct binding of chordin toBMP-4. Cell. 1996;86:589–598.

6. Nakayama N, Han CY, Cam L, Lee JI, Pretorius J, Fisher S, Rosenfeld R,Scully S, Nishinakamura R, Duryea D, Van G, Bolon B, Yokota T, ZhangK. A novel chordin-like BMP inhibitor, CHL2, expressed preferentially in

Spr

out L

engt

h [m

m]

35

0

105

15

202530

BMPER Noggin

-- + ++- + -

*

F

E

G

D

Spr

out L

engt

h [m

m] 30

35

0

10

siRNA

BMP-4 I

BMP-4 II

Cont

Cont

5

15

20

25 *BMPER

35

A

Tubulin

phospho SMAD 1/5

Cont

BMPER I

BMPER IIsiRNA Con

t

BMPER I

BMPER II

BMP-4 - +-+-+

BMPER

CB

0

200

400

100

300

500

Spr

out L

engt

h [µ

m]

BMPER I

BMPER IICon

tsiRNA Con

t

*BMP-4

Mig

rate

d C

ells

(fol

d in

duct

ion

vs c

ontro

l)

0

200

100

300

BMPER I

BMPER IICon

tsiRNA Con

t

*BMP-4

BMPER Noggin

-- + ++- + -

*

Mig

rate

d C

ells

(fol

d in

duct

ion

vs c

ontro

l)

0

200

100

300

siRNA

BMP-4 I

BMP-4 II

Cont

Cont

*BMPER

Mig

rate

d C

ells

(fol

d in

duct

ion

vs c

ontro

l)

0

200

100

300

Figure 8. Functional interaction between BMPER and BMP4.A, Impaired BMP-4 induced Smad phosphorylation in BMPER-depleted cells. HUVECs were transfected with either of 2 BMPER-specific siRNAs or scrambled control. After 48 hours, cells werestimulated for 20 minutes with BMP-4 (50 ng/mL), lysed, and sub-jected to Western blot analysis performed with the indicated anti-bodies. B, Impaired BMP-4 induced HUVEC sprouting of BMPER-depleted cells. siBMPER-silenced HUVECs or control cells wereembedded as spheroids in a collagen matrix. Quantitative analysisof cumulative sprout length of spheroids after 24 hours of stimula-tion with BMP-4 is presented. C, Impaired BMP-4–inducedHUVEC migration of BMPER-depleted cells. Quantitative analysisof transmigration of BMPER-depleted HUVECs and control cellsstimulated with BMP-4. Means�SD; n�3. *P�0.001 vs control.BMP-4 was inhibited using either specific siRNAs (D and E) ornoggin (F and G). D and F, Cumulative sprout length of capillary-like structures was measured. E and G, HUVEC migration assay.Means�SD. One of 3 representative experiments is shown.*P�0.05 vs control.




chondrocytes of developing cartilage and osteoarthritic joint cartilage.Development. 2004;131:229–240.

7. Smith WC, Harland RM. Expression cloning of noggin, a new dorsalizingfactor localized to the Spemann organizer in Xenopus embryos. Cell.1992;70:829–840.

8. Stabile H, Mitola S, Moroni E, Belleri M, Nicoli S, Coltrini D, Peri F,Pessi A, Orsatti L, Talamo F, Castronovo V, Waltregny D, Cotelli F,Ribatti D, Presta M. Bone morphogenic protein antagonist Drm/gremlinis a novel proangiogenic factor. Blood. 2007;109:1834–1840.

9. Oelgeschlager M, Larrain J, Geissert D, De Robertis EM. The evolu-tionarily conserved BMP-binding protein Twisted gastrulation promotesBMP signalling. Nature. 2000;405:757–763.

10. Moser M, Binder O, Wu Y, Aitsebaomo J, Ren R, Bode C, Bautch VL,Conlon FL, Patterson C. BMPER, a novel endothelial cell precursor-derived protein, antagonizes bone morphogenetic protein signaling andendothelial cell differentiation. Mol Cell Biol. 2003;23:5664–5679.

11. Balemans W, vanHul W. Extracellular regulation of BMP signaling invertebrates: a cocktail of modulators. Dev Biol. 2002;250:231–250.

12. Binnerts ME, Wen X, Cante-Barrett K, Bright J, Chen HT, Asundi V,Sattari P, Tang T, Boyle B, Funk W, Rupp F. Human Crossveinless-2 isa novel inhibitor of bone morphogenetic proteins. Biochem Biophys ResCommun. 2004;315:272–280.

13. Moser M, Yu Q, Bode C, Xiong J-W, Patterson C. BMPER is a conservedregulator of hematopoietic and vascular development in zebrafish. J MolCell Cardiol. 2007;43:243–253.

14. Conley CA, Silburn R, Singer MA, Ralston A, Rohwer-Nutter D, OlsonDJ, Gelbart W, Blair SS. Crossveinless 2 contains cysteine-rich domainsand is required for high levels of BMP-like activity during the formationof the cross veins in Drosophila. Development. 2000;127:3947–3959.

15. Ikeya M, Kawada M, Kiyonari H, Sasai N, Nakao K, Furuta Y, Sasai Y.Essential pro-Bmp roles of crossveinless 2 in mouse organogenesis.Development. 2006;133:4463–4473.

16. Rentzsch F, Zhang J, Kramer C, Sebald W, Hammerschmidt M. Cross-veinless 2 is an essential positive feedback regulator of Bmp signalingduring zebrafish gastrulation. Development. 2006;133:801–811.

17. Zhou Q, Heinke J, Vargas A, Winnik S, Krauss T, Bode C, Patterson C,Moser M. ERK signaling is a central regulator for BMP-4 dependentcapillary sprouting. Cardiovasc Res. 2007;76:390–399.

18. Chang K, Weiss D, Suo J, Vega JD, Giddens D, Taylor WR, Jo H. Bonemorphogenic protein antagonists are coexpressed with bone morphogenicprotein 4 in endothelial cells exposed to unstable flow in vitro in mouse

aortas and in human coronary arteries: role of bone morphogenic proteinantagonists in inflammation and atherosclerosis. Circulation. 2007;116:1258–1266.

19. Paik JH, Kollipara R, Chu G, Ji H, Xiao Y, Ding Z, Miao L, Tothova Z,Horner JW, Carrasco DR, Jiang S, Gilliland DG, Chin L, Wong WH,Castrillon DH, DePinho RA. FoxOs are lineage-restricted redundanttumor suppressors and regulate endothelial cell homeostasis. Cell. 2007;128:309–323.

20. Potente M, Urbich C, Sasaki K, Hofmann WK, Heeschen C, Aicher A,Kollipara R, DePinho RA, Zeiher AM, Dimmeler S. Involvement of Foxotranscription factors in angiogenesis and postnatal neovascularization.J Clin Invest. 2005;115:2382–2392.

21. Murphy-Ullrich JE. The de-adhesive activity of matricellular proteins: isintermediate cell adhesion an adaptive state? J Clin Invest. 2001;107:785–790.

22. Mizutani K, Ito H, Iwamoto I, Morishita R, Deguchi T, Nozawa Y, AsanoT, Nagata KI. Essential roles of ERK-mediated phosphorylation ofvinexin in cell spreading, migration and anchorage-independent growth.Oncogene. 2007;26:7122–7131.

23. Langenfeld EM, Langenfeld J. Bone morphogenetic protein-2 stimulatesangiogenesis in developing tumors. Mol Cancer Res. 2004;2:141–149.

24. Valdimarsdottir G, Goumans MJ, Rosendahl A, Brugman M, Itoh S,Lebrin F, Sideras P, ten Dijke P. Stimulation of Id1 expression by bonemorphogenetic protein is sufficient and necessary for bone morpho-genetic protein-induced activation of endothelial cells. Circulation. 2002;106:2263–2270.

25. Serpe M, Umulis D, Ralston A, Chen J, Olson DJ, Avanesov A, OthmerH, O’Connor MB, Blair SS. The BMP-binding protein Crossveinless 2 isa short-range, concentration-dependent, biphasic modulator of BMP sig-naling in Drosophila. Dev Cell. 2008;14:940–953.

26. Kiyono M, Shibuya M. Inhibitory Smad transcription factors protectarterial endothelial cells from apoptosis induced by BMP4. Oncogene.2006;25:7131–7137.

27. O’Connor MB, Umulis D, Othmer HG, Blair SS. Shaping BMP morphogengradients in the Drosophila embryo and pupal wing. Development. 2006;133:183–193.

28. Wang YC, Ferguson EL. Spatial bistability of Dpp-receptor interactionsduring Drosophila dorsal-ventral patterning. Nature. 2005;434:229–234.

29. Zhang JL, Huang Y, Qiu LY, Nickel J, Sebald W. von Willebrand factortype C domain-containing proteins regulate bone morphogenetic proteinsignaling through different recognition mechanisms. J Biol Chem. 2007;282:20002–20014.




Online Supplement Heinke et al., BMPER is an endothelial cell regulator and…

Materials and Methods

Cell Culture

All experiments were performed according to the principles outlined in the Declaration

of Helsinki for the use of human tissue. Human umbilical vein ECs (HUVECs) were

freshly isolated from human umbilical veins of newborns by collagenase digestion 1

cultured in endothelial basal media supplemented with hydrocortisone, bovine brain

extract, epidermal growth factor and 10% FBS (EBM-1) and used for experiments until

the 6th passage. Human heart, lung and skin microvascular ECs (HMECs) were cultured

in EBM-2 MV. C166 yolk sac endothelial precursor cells were cultured in DMEM

(Gibco) with 10% FBS. Skin HMECs were kindly provided by V. Schacht, Freiburg,

Germany. Other cells, cell culture media and reagents were purchased from Lonza

Group Ltd, Switzerland.

Transient transfection of HUVECs

FoxO3a wildtype (pECE-HA FoxO3a_wt) and constitutively active Foxo3a A3 (pECE-

HA FoxO3a_A3) expression constructs were generously provided by M. Potente,

Frankfurt. For transient transfections, DNA plasmids were introduced into HUVECs

using PromoFectin-HUVEC transfection reagent according to the manufacturer's

instructions (Promocell).

Immunocytochemistry

C166 cells grown on glass coverslips were fixed in ice-cold Methanol/Acetone at -20°C

for 10 minutes. Cells were blocked with 10% donkey serum for 30 minutes at room

temperature and incubated with the polyclonal BMPER Antibody (1:50; R&D), donkey-

anti goat-FITC (1:200; Dianova) and for nuclei-staining with DAPI (1:30000; Sigma).


All photographs were taken with Zeiss Axioplan2 and analyzed with Zeiss Axiovision

Rel. 4.6.

For actin cytoskeleton staining HUVECs were grown for 24 h on Fibronectin coated

glass coverslips in 2% FBS EBM-1 containing either BMPER (20 ng/ml) or BSA

control. Cells were fixed in 4% paraformaldehyd for 15 minutes, blocked and

permeabilized with 2% BSA and 1% Triton X-100 for 30 minutes and incubated with

phalloidin-TRITC (1:800; Sigma). Images were aquired with a Zeiss 510 confocal

microscope and analyzed with Zeiss Axiovision Rel. 4.6.

RNA interference

BMPER-siRNAs were purchased from Ambion. The sequences were siBMPER I:

forward: 5’-GCACCUUAGUCACAUACCCtt-‘3, reverse 5‘-

GGGUAUGUGACUAAGGUGCtg-‘3; siBMPER II: forward: 5‘-

GCUGCCUCUUUCGAAGUGAtt-‘3, reverse: 5‘-UCACUUCGAA AGAGGCAGCtc-

‘3. BMP-4 and FoxO3a siRNAs were purchased from Invitrogen. The sequences were:

siBMP-4 I: forward: 5’-AGAUCCACAGCACUGGUCUUGAGUA-‘3; reverse: 5’-

UACUCAAGACCAGUGCUGUGGAUCU-‘3; siBMP-4 II: forward: 5’-GGGCU

UCCACCGUAUAAACAUUUAU-‘3, reverse: 5’-

AUAAAUGUUUAUACGGUGGAAGCC C-‘3, siFoxO3a I: forward: 5’-

CAGAAUGAGGGAACUGGCAAGAGCU-‘3, reverse: 5’-

AGCUCUUGCCAGUUCCCUCAUUCUG-‘3; siFoxO3a II: forward: 5’-

AGCAAGUUCUG AUUGACCAAACUUC-‘3, reverse: 5’-

GAAGUUUGGUCAAUCAGAACUUGCU-‘3. Scrambled negative control-Alexa

Fluor 488 nm was purchased from Qiagen. For siRNA transfection Lipofectamine

RNAiMAX was used according to the manufacturer's protocol (Invitrogen).


Transfection efficiency was confirmed by quantitative real-time (q) PCR. Functional

cell culture assay were performed between 8 to 48h post transfection.

Real-Time PCR

Quantitative real-time PCR analysis was performed using the real-time PCR detection

system (Bio-Rad) with sequence-specific primer pairs for BMPER (forward primer: 5’-

AGG ACA GTG CTG CCC CAA ATG-‘3 and reverse primer: 5’-TAC TGA CAC

GTC CCC TGA AAG-‘3), BMP-4 (forward primer: 5’- CAC GAA GAA CAT CTG

GAG AAC-‘3 and reverse primer: 5’- CCC TTG AGG TAA CGA TCG GCT-‘3),

FoxO3a (forward primer: 5’-CTA CGA GTG GAT GGT GCG TTG C-’3 and reverse

primer: 5’-CGG CTC TTG GTA TAC TTG TTG C-’3) and human RNA-Polymerase II

(hRP) (forward primer: 5’-GCA CCA CGT CCA ATG ACA T-’3 and reverse primer:

5’-GTG CGG CTG CTT CCA TAA-3’) Quantification was performed using MyiQ

lightcycler software. Total RNA was extracted from HUVEC using the Aurum RNA

Mini Kit (Bio-Rad). Reverse transcription was performed with iScript cDNA-Kit (Bio-

Rad). Knockdown efficiency was calculated using the ∆∆CT method. The housekeeping

gene hRP was used for internal normalization

Apoptose Flow Cytometry Analysis

HUVECs grown in 6-well culture dishes (Nunc) were stimulated for 24 h before FACS-

Analysis with different concentrations of BMPER. As a positive control HUVECs were

incubated for 4 h with Staurosporin (1 nmol/ml; Sigma). For staining the AnnexinV-Kit

was used according to the protocol of the manufacturer (BD Biosciences).


Adhesion Assay

For adhesion experiments, 96-well ELISA plates were coated at 4°C overnight with 50

µg/ml collagen I, 10 µg/ml fibronectin, 10 µg/ml gelatine (all Sigma), 20 μg/ml

fibrinogen (Calbiochem), or 2 μg/ml vitronectin (Promega). Following the coating, the

wells were blocked with 1% BSA for 1 h at 25°C and washed 3 times with PBS.

HUVECs were pre-treated as described for the matrigel sprouting assay. A cell

suspension (1 × 105 cells) in EBM (0.5% BSA) was allowed to adhere for 1 h at 37°C in

a cell culture incubator. Prior to analysis plates were washed 3 times with PBS

(containing Ca2+ and Mg2+) and permeabilization buffer (3 mg/ml phosphatase substrate

(Sigma), 0.1% Triton X-100 and 100 mM Sodium acetate) was added to each well and

incubated for at least 1 h at 37°C. Absorbance was read at 405 nm in a Spectramax plate

reader.

Western Blot Analysis

Cells were washed twice with ice-cold phosphate buffered saline (PBS), lysed on ice in

RIPA buffer and then centrifuged at 10.000 x g for 10 min at 4°C to remove insoluble

material. The supernatant was collected and total cellular protein was quantified using

Bradford protein assay (Bio-Rad). Equal amounts of protein were loaded and separated

by a 12% SDS-PAGE. Electroblotting was performed to transfer proteins to

nitrocellulose. After blocking with TBST supplemented with non-fat dried milk, the

western blots were incubated overnight at 4°C with antibodies against hBMPER

(1:2500, R&D), β-Tubulin (1:5000, R&D) p-Erk 1/2, Erk 1/2, pSmad 1/5 and Smad 5

(1:2000, Cell Signaling Technologies). Secondary Antibodies conjugated to horseradish

peroxidase were from R&D and Dako. Visualisation was performed by an ECL system

(Amersham Bioscience).


Chicken embryo chorioallantoic membrane (CAM) assay

Fertilized white Leghorn chicken eggs (Gallus gallus) (Tierzucht Bronner, Germany)

were incubated in a humidified egg incubator at 37.8°C and 67% humidity. At day 3 of

development (E3), a window was cut into the eggshell and sealed again with adhesive

plaster (Durapore, 3M). At E9 BMPER (0.1µg, 0.5µg) or VEGF (0.3µg) was applied

directly to the CAM within the central area of a Thermanox (Nunc) plastic ring.

Membranes were harvested at E13, fixed with 4% PFA. Endothelium was stained by

biotinylated Sambucus nigra lectin (Vector Laboratories), streptavidin-Alexa Fluor 546

conjugate (Invitrogen) and visualized in en face views by fluorescent microscopy. For

analysis the application area within the ring was compared with the control area outside

the ring within the same egg.

Reference

1. Elgjo RF, Henriksen T, Evensen SA. Ultrastructural identification of umbilical cord vein endothelium in situ and in culture. Cell Tissue Res. 1975;162:49-59.


Figure Legends

Online Figure I: Timeline for specific silencing of BMP-4by siRNA in HUVECs and effect on

endothelial sprouting on matrigel. (A) BMP-4 mRNA expression after 24, 48 and 72 hours

post-transfection with the siRNA BMP-4 I and II, respectively, compared to scrambled

siRNA control. BMP-4 mRNA was quantified by real-time (q) PCR using specific primers for

BMP-4 and hRP as internal control. Knock down efficiency was calculated using ∆∆CT

method. Data are presented as mean ± SD; n = 3. * = p < 0.005 versus control. (B) A

representative western blot with the indicated antibodies blot is shown. (C) For matrigel assay

BMP-4 siRNA silenced HUVECs or control cells (D) as well as with Noggin antagonized

HUVECs were used. In addition to the results of cumulative sprout length in Figure 8E&G

branch points were counted. Data are presented as mean ± SD result of 1 of 3 independent

experiments are shown. * = p < 0.0001 versus control.

Online Figure II: Working model for concentration-dependence of BMPER. (A): Physiologic

amounts of BMPER facilitate BMP-4 binding to its receptor. (B): High amounts of BMPER

bind to extracellular BMP-4 and thereby prevent binding of BMP-4 to the receptor.

BMP-4 I

BMP-4 II

ContsiRNA

Cont

bran

ch p

oint

s

0

60

20

80

40

100 BMPER

*

C

bran

ch p

oint

s

*

0

60

20

80

40

100

BMPER Noggin

-- + ++- + -

D

A

mR

NA

expr

essi

on [%

] vs.

Con

t

*

100

75

0

25

50

**

*

*

*48 h24 h 72 h

BMP-4 I

BMP-4 II

Cont

BMP-4 I

BMP-4 IIsiRNA

BMP-4 II

BMP-4 I

BCon

tBMP-4

I

BMP-4 II

BMP-4

Tubulin

siRNA

Online Figure I: Timeline for specific silencing of BMP-4by siRNA in HUVECs and effect on endothelial sprouting on matrigel

BMP4

extracellular

B

A

extracellular

BMP4

BMP4

BMP4

BMP4

BMP4

BMP4BMP4

Online Figure II: Working model for concentration-dependence of BMPER

BMPER

BMPE

R BMPER

BMPER

BMP4

BMP4

BMPER

BMPER

BMPER BMPERBMPER BM

PER

BMPE

R

Helbing, Anna Laib, Hellmut Augustin, Christoph Bode, Cam Patterson and Martin MoserJennifer Heinke, Leonie Wehofsits, Qian Zhou, Christoph Zoeller, Kim-Miriam Baar, Thomas

Dependent Angiogenesis−BMPER Is an Endothelial Cell Regulator and Controls Bone Morphogenetic Protein-4

Print ISSN: 0009-7330. Online ISSN: 1524-4571 Copyright © 2008 American Heart Association, Inc. All rights reserved.is published by the American Heart Association, 7272 Greenville Avenue, Dallas, TX 75231Circulation Research

doi: 10.1161/CIRCRESAHA.108.1784342008;103:804-812; originally published online September 11, 2008;Circ Res.

http://circres.ahajournals.org/content/103/8/804World Wide Web at:

The online version of this article, along with updated information and services, is located on the

http://circres.ahajournals.org/content/suppl/2008/09/11/CIRCRESAHA.108.178434.DC1.htmlData Supplement (unedited) at:

http://circres.ahajournals.org//subscriptions/

is online at: Circulation Research Information about subscribing to Subscriptions:

http://www.lww.com/reprints Information about reprints can be found online at: Reprints:

document. Permissions and Rights Question and Answer about this process is available in the

located, click Request Permissions in the middle column of the Web page under Services. Further informationEditorial Office. Once the online version of the published article for which permission is being requested is

can be obtained via RightsLink, a service of the Copyright Clearance Center, not theCirculation Researchin Requests for permissions to reproduce figures, tables, or portions of articles originally publishedPermissions:


http://circres.ahajournals.org/content/103/8/804

http://circres.ahajournals.org/content/suppl/2008/09/11/CIRCRESAHA.108.178434.DC1.html

http://www.ahajournals.org/site/rights/

http://www.lww.com/reprints

http://circres.ahajournals.org//subscriptions/


Date post:	21-Nov-2023
Category:	Documents
Upload:	independent
View:	0 times
Download:	0 times

BMPER Is an Endothelial Cell Regulator and Controls Bone Morphogenetic Protein-4-Dependent...

Documents