Antifungal activity of the leaf extracts of laurel (Laurus nobilis L.), orange (Citrus sinensis...

IDENTIFICATION OF RESISTANCE TRAITS TO FUSARIUMAND VERTICILLIUM WILT IN ITALIAN TOMATO LAN-DRACES. N. Acciarri1, G.L. Rotino2, E. Sabatini2, S. Voltat-torni1, D. Valentino3 and G. Tamietti3. 1CRA, Istituto Sperimen-tale per l’Orticoltura, Via Salaria 1, 63030 Monsampolo del Tronto(AP), Italy. 2CRA, Istituto Sperimentale per l’Orticoltura, ViaPaullese 28, 26836 Montanaso Lombardo, (LO), Italy. 3Diparti-mento di Valorizzazione e Protezione delle Risorse Agroforestali,Sezione di Patologia Vegetale, Università degli Studi di Torino, ViaL. da Vinci 44, 10095 Grugliasco (TO), Italy. E-mail: [email protected]

A representative number of tomato landraces belonging todifferent typologies, collected in the main Italian tomato-growingareas were evaluated for resistance to Fusarium oxysporum f. sp.lycopersici and Verticillium dahliae by root dip inoculationmethod. None of the screened landraces was completely resistantto Fusarium wilt. Nevertheless high levels of tolerance werefound in ‘Ovalino’, ‘Locale Valle d’Agri’, ‘Patataro pop. 29’ (atypical accession from Campania), ‘Sorrentino’ (a pink tomato se-lected in the Sorrento area) and ‘Mezzo lungo’, and intermediatetolerance in additional 11 landraces. Similarly, most of the geno-types were highly susceptible to V. dahliae, but ‘Eraldo 4’, be-longing to Cuore di Bue di Albenga type, ‘Rosa di Rotonda’ and‘Locale Valle d’Agri’ (an accessions with pink fruit from Basilica-ta) and the breeding line ‘L 16-94’, appeared to be tolerant,showing disease incidence ranging from 72.2 to 100% and dis-ease severity from 26.6 to 30%, whereas ‘Sorrentino’ was as re-sistant as ‘Florida’. Two new molecular markers linked to Verti-cillium resistance genes were developed on the sequence informa-tion in GenBank for Ve genes and validated on several resistantvarieties. Genetic analysis carried out using these markersdemonstrated that the same resistant alleles are present both in‘Sorrentino’ and ‘Eraldo 4’. Two years of individual selection andself-fertilization yielded breeding lines of ‘Sorrentino’ resistant toV. dahliae and highly tolerant to F. oxysporum. ‘Eraldo 4’ is cur-rently used as parent for the production of resistant and typicalHF1 hybrids of the ‘Cuor di Bue di Albenga’ which is one of theItalian most popular typology for fresh consumption.

Research financed by MIPAF, project PROM.

IDENTIFICATION AND CHARACTERIZATION OF APPLEDIMPLE FRUIT VIROID IN LEBANON. M. Afechtal1, E.Choueiri2, S. El Zammar2, F. Jreijiri2, C. Hobeika 2, A. Myrta1*

and F. Di Serio3. 1Istituto Agronomico Mediterraneo, Via Ceglie 9,70010 Valenzano (BA), Italy. 2Department of Plant Protection,Lebanese Agricultural Research Institute, Tal Amara, P.O.Box 287,Zahlé, Lebanon. 3Istituto di Virologia Vegetale del CNR, Sezione diBari and Dipartimento di Protezione delle Piante e MicrobiologiaApplicata, Università degli Studi, Via Amendola 165/A, 70126Bari, Italy. E-mail: [email protected]

Apple trees of cv. Starking Delicious producing fruits with de-pressed green spots 3-4 mm in diameter, scattered on the wholefruit surface and merging around the calyx, were observed in theBekaa valley (Lebanon). These symptoms resembled those of ap-ple dimple fruit and dapple apple diseases induced by Apple dim-ple fruit viroid (ADFVd) and Apple scar skin viroid (ASSVd), re-spectively. Dot-blot hybridization using digoxigenin-labelled ri-boprobes, multiplex RT-PCR amplification assay specific for de-tecting these viroids in both single and mixed infections and se-quencing of the generated amplicons showed that the symptomswere associated exclusively with the presence of ADFVd, where-as ASSVd was never detected. Full length ADFVd cDNAs from

one symptomatic apple tree were also amplified and cloned. Se-quencing of four independent clones identified ADFVd sequencevariants composed by 307 nt with limited variability. Multiple se-quence alignment of these variants with those reported previouslyin databank allowed the identification of one additional polymor-phic position in the viroid genome. To our knowledge, this is thefirst report of ADFVd in Lebanon and the first in a country otherthan Italy. Tissue-printing hybridization was successfully used fora large-scale survey for the presence of ADFVd and ASSVd inLebanon, the results of which are presented and discussed.

* Present address: Certis Europe B.V., Via A. Guaragna 3, 21047Saronno, Italy.

IDENTIFICATION AND CHARACTERIZATION OF PEARBLISTER CANKER VIROID IN MALTA AND IN BOSNIA ANDHERZEGOVINA. M. Afechtal1, B. Lolic1, S. Matic2, D. Attard3,A. Myrta1* and F. Di Serio2. 1Istituto Agronomico Mediterraneo,Via Ceglie 9, 70010 Valenzano (BA), Italy. 2Istituto di VirologiaVegetale del CNR, Sezione di Bari and Dipartimento di Protezionedelle Piante e Microbiologia Applicata, Università degli Studi, ViaAmendola 165/A, 70126 Bari, Italy. 3Plant Biotechnology Center,Ministry for Rural Affairs and the Environment, Lija, Malta. E-mail: [email protected]

Preliminary surveys to investigate the presence and spread ofpome fruit viroids in Bosnia and Herzegovina and in Malta werecarried out by a tissue printing hybridization (TPH) method.More than 300 samples of apple and pear trees from Bosnia andHerzegovina were tested for the presence of Apple scar skin viroid(ASSVd), Apple dimple fruit viroid (ADFVd) and Pear blistercanker viroid (PBCVd). Whereas ASSVd and ADFVd were notdetected, almost 17% of assayed pear samples, belonging to 13different cultivars, gave positive TPH signals when hybridizedwith a PBCVd-specific cRNA probe. In parallel experiments, a to-tal of 113 pear samples (mainly cv Bambinella) from Malta weretested for PBCVd showing an infection rate of 12%. These resultswere largely confirmed by Northern-blot hybridization assays andby RT-PCR followed by cloning and sequencing of the amplifiedcDNAs. No symptoms were observed in infected field-growntrees. Seedlings of the pear indicator LA62 were graft-inoculatedwith bark tissues from several new PBCVd isolates from bothcountries. Six month post-inoculation, molecular hybridization as-says and RT-PCR followed by direct sequencing of the amplicondetected the viroid in the inoculated plants which remained symp-tomless. Further molecular characterization of several of the newPBCVd isolates allowed the identification of previously unreport-ed polymorphic positions in the viroid genome. Altogether, thesedata show for the first time that PBCVd infects pear trees inBosnia and Herzegovina and in Malta, and validate the TPHmethod for large scale surveys of pome fruit viroid infections.

* Present address: Certis Europe B.V, Via A. Guaragna 3, 21047Saronno, Italy

PHYTOPHTHORA CINNAMOMI ON QUERCUS ILEX INCENTRAL ITALY. T. Annesi, L. D’Amico, G. Mazza and E.Motta. CRA, Istituto Sperimentale per la Patologia Vegetale, ViaC.G. Bertero 22, 00156 Roma, Italy. E-mail: [email protected]

A decline was observed in a Quercus ilex nursery in centralItaly where, three years ago, about 200 five-year-old trees hadbeen planted to produce trees for urban streets and gardens.During winter 2006-2007 several trees showed necrosis of the

Journal of Plant Pathology (2007), 89 (3, Supplement), S27-S68 Edizioni ETS Pisa, 2007 S27

Edizioni ETS Pisa, 2007

005 Riassunti FINALI_S27 4-12-2007 11:15 Pagina 27

collar and roots and wilting, while scattered trees had alreadydied in previous years. To detect the causal agent, isolations weremade from altered tissues of symptomatic plants on PDA and ona PARPNH selective medium. Further isolations were attemptedfrom soil samples collected near diseased and symptomlessplants. The fungal isolates obtained were investigated for bothmorphological characters and for the sequence of the ITS regionof rDNA and were identified as Phytophthora cinnamomi Rands.Pathogenicity was confirmed by successful inoculation on three-year-old holm oaks. P. cinnamomi is an aggressive and poly-phagous pathogen, associated with severe decline of Q. ilex inSpain and Portugal. It was found also in Italy in a holm oak forestbut in soil samples only. To our knowledge, this is the first reportof P. cinnamomi on Q. ilex in Italy.

CORRELATION BETWEEN THE OCCURRENCE OF PATHO-GENIC FUNGAL ENDOPHYTES IN HEALTHY OAK TREESAND OAK DECLINE. N. Anselmi, M. Nasini, A. Mazzaglia, A.Librandi, E. Rocco and F. Ravaioli. Dipartimento Protezione dellePiante, Università degli Studi della Tuscia, Via S. Camillo de Lellis,01100 Viterbo, Italy. E-mail: [email protected]

This research is part of studies on fungal endophytes involvedin oak decline. We analyzed the endophytic microflora in healthytrees of 11 oak stands of central Italy characterized by differentlevels of decline. Four healthy plants were selected per site, and100 samples of one- and three-year-old branches were collectedfrom each plant. After surface sterilisation, fragments of thesesamples were transferred to an appropriate substrate. The fungalisolates were subcultured and identified on morphological andmolecular bases. Most of the isolated species in the different siteswere the same, including pathogens, i.e. Discula quercina, Biscog-nauxia mediterranea, Coryneum quercinum, Cytospora sp., Pho-mopsis spp., Diplodia corticola, etc. and non-pathogens, i.e. Acre-monium sp., Aureobasidium pullulans, Cladosporium cladospori-oides, Epicoccum sp., Gliocladium roseum, Thrichoderma spp.,Verticillium lecanii, etc. The incidence of endophytic pathogens,agents of bark necrosis, particularly B. mediterranea and P. querci-na, was higher in declining oak stands, whereas non-pathogenicendophytes (e.g. A. pullulans and G. roseum) were less represent-ed in the same conditions. The increase of inoculum pressure dueto the dissemination of propagules of bark necrosis agents in de-clining oak trees, most likely leads to an increase of new infec-tions to healthy plants. The possible use of these results to definea “forest decline risk index” based on the abundance of the en-dophytic bark pathogens in healthy plants is discussed.

MICROBIAL RESPONSE TO ORGANIC MATTER AMEND-MENTS MODULATES PHYTOTOXICITY AND BIOLOGI-CAL CONTROL EFFECTIVENESS. V. Antignani, G. Puopolo,G. Bonanomi, C. Pane, A. Zoina and F. Scala. Dipartimento diArboricoltura, Botanica e Patologia Vegetale, Sezione di PatologiaVegetale, Università degli Studi di Napoli “Federico II”, Via Univer-sità 100, 80055 Portici (NA), Italy. E-mail: antignani_vincenzo@ libero.it

Recent studies demonstrate that the use of organic amend-ments for the control of plant diseases can produce suppressiveor conducive effects. Disease enhancement has often been associ-ated to the release of phytotoxic compounds from decaying or-ganic matter in the presence of microorganisms. In this work weevaluated the phytotoxicity of Medicago sativa residues (MSR) us-ing the Lepidium sativum test. Seeds of this species were sawn in

pots filled with quartz sand amended with MSR at four concen-trations (0%, 0.1%, 0.3%, 1% w/w). Successively, pots were in-oculated with three different concentrations of microorganismsuspensions. Ten fungi, ten bacteria and three formulations of acommercial microbial consortium were individually used forthese trials. At the same time, the antagonistic activity of the tenbacteria toward Rhizoctonia solani was evaluated in a dual culturemethod, on a growth medium amended with MSR at 0.1% and0.3% final concentration. The analysis of the data obtained in thefirst group of tests showed that phytotoxicity on Lepidiumsativum increased with the amount of incorporated MSR andwith the density of the microbial inoculum. Arthrobacter sp., En-terobacter aerogenes and Trichoderma harzianum produced thehighest phytotoxicity effects, while the microbial consortia werethe least phytotoxic. The antagonistic activity of the bacteriaagainst Rhizoctonia solani was significantly influenced, either pos-itively or negatively, by MSR content in the growth medium.These preliminary results show that the phytotoxicity of MSR de-pends both on the microbial species and on its density.

EVALUATION OF THE ANTAGONISTIC ACTIVITY OFSOME BACTERIA AGAINST MELON SOIL-BORNEPATHOGENS. M. Antonelli, M.P. Aleandri, N. Vinci, G. Chilosiand L. Varvaro Dipartimento di Protezione delle Piante, Univer-sità degli Studi della Tuscia, Via S. Camillo de Lellis, 01100 Viter-bo, Italy. E-mail: [email protected]

Repeated melon cropping and different soil sterilisation treat-ments cause a biological impoverishment of soil fertility and anincrease of diseases caused by soil-borne pathogens. To developeffective and sustainable strategies for soil-borne pathogen man-agement, we have sampled soils from plots given over to melon inthe province of Viterbo and have isolated and selected fluores-cent and spore-forming bacteria. These isolates, were character-ized biochemically and tested for their in vitro activity againstMonosporascus cannonballus, Fusarium oxysporum f. sp. melonis,Rhizoctonia solani, Verticillium dahliae and Erwinia carotovorasubsp. Carotovora, and for their ability to produce toxic volatilecompounds (i.e. HCN). Bacterial isolates of Pseudomonas putida,P. fluorescens and Bacillus spp. that gave positive responses wereused for in vivo tests to verify their role as plant growth promot-ers or as deleterious rhizobacteria with plant growth inhibitoryeffects through bacterization of melon, lettuce and tomato seed.The bacterial isolates analysed during this study could be a po-tential tool for biological or integrated pest management pro-grams for farmers in the area of Viterbo.

NEEDS FOR PHYTOBACTERIOLOGICAL ANALYSES TOSUPPORT THE REGIONAL PHYTOSANITARY SERVICES INITALY. M. Antonelli, G. Balestra, C. Bazzi, P. Bella, R. Benedet-ti, E. Biondi, R. Buonaurio, M. Calvi, A. Calzolari, V. Catara, G.Cirvilleri, D. D’Ascenzo, A. Fabi, M. Fiori, G. Gianetti, M.Guelfi, N.S. Iacobellis, P. Lancioni, G. Licciardello, L. Lindner,P. Lo Cantore, S. Loreti, C. Lucchese, C. Marcone, L. Marinoni,E. Mariotti, P. Martini, U. Mazzucchi, P. Minardi, C. Moretti, C.Morone, D. Pasqua di Bisceglie, G. Petris, A. Quattrucci, A.Rossetti, A. Saccardi, M. Scortichini, F. Sesto, A. Sisto, E. Ste-fani, G. Surico, S. Tegli, F.G. Troiano, L. Varvaro, A. Vincenzi,M. Zaccardelli, V. Zagari, R. Zasso and A. Zoina. Gruppo di La-voro di Batteriologia della Società Italiana di Patologia Vegetale. E-mail: [email protected]

The Legislative Decree no. 214 dated 19-9-2005 introduced in

S28 Journal of Plant Pathology (2007), 89 (3, Supplement), S27-S68


Italy the Council Directive 2000/29/CE, as amended by theCouncil Directive 2002/89/CE. The aforesaid Decree enforcedprotective measures against the introduction and spread into theCommunity of organisms harmful to plants/plants products. Inthe annexes of the Decree, there are 20 phytopathogenic bacteria.The key measure foreseen in the Decree is the strengthening ofplant health checks, carried out by the Regional PhytosanitaryServices (Servizi Fitosanitari Regionali, SFR) at the place of pro-duction and on imported/exported plants/plant products. In thisrespect, laboratory analyses are essential for the detection of la-tent infections. Analyses are currently carried out in laboratoriesbelonging to SFR or, under the supervision of each SFR, in ac-credited private or public laboratories. The Decree 214/2005 laysdown a national laboratory network (art.53) to support SFR inperforming the analyses. This network operates under the super-vision of a central Phytosanitary Committee (art.52). In 2006, aspecific enquiry showed that SFR are characterised by differentneeds as they carry out different bacteriological analyses for thecrops grown in their areas and for controls of materials importedthrough the relevant points of entry. However, all SFR had as acommon task the detection of three quarantine bacteria, Ralsto-nia solanacearum, Clavibacter michiganensis and Erwinia amylovo-ra. The national laboratory network, envisaged by Decree214/2005, should take into account the demand for analyses ex-pressed by the SFR, that have already provided useful data re-garding their bacteriological needs. This national laboratory net-work could provide the SFR with an effective support also in thecontrol of regulated non quarantine pests.

EFFECT OF PHYSICAL AND CHEMICAL TREATMENTS ONBACTERIAL POPULATIONS PRESENT IN MELON-CULTI-VATED SOILS. M. Antonelli, R. Reda, G. Chilosi and L. Var-varo Dipartimento di Protezione delle Piante, Università degli Stu-di della Tuscia, Via S. Camillo de Lellis, 01100 Viterbo, Italy. E-mail: [email protected]

In recent years melon crops in the north of Latium were dra-matically affected by several soil-borne pathogens, especially fun-gi. As part of a monitoring disease project, we started a microbio-logical study to: (i) isolate from the soil culturable bacteria withantagonistic activity and, (ii) secure information on the qualitativeand quantitative composition of bacterial populations in soilstreated with steam or solarisation (physical treatments) ormetham sodium (chemical treatment). We focused our attentionon two bacterial groups with a well known antagonistic activity:fluorescent and spore-forming bacteria. Soil was sampled beforetreatments and after some months, inside and ouside differentplastic tunnels. The data obtained showed that in steam treatedor solarisated soils, fluorescent bacterial populations were notisolated from inside the tunnel, whereas no significant variationswere observed in the chemically treated soil. In solarisated soil anincrease of spore-forming bacterial populations was found. Inother tunnels no significant variations were observed. More bio-logical complexity and variability was found in soils collectedoutside tunnels, where weed roots grew in the apparent absenceof the effect of treatments.

TRANSPOSON TAGGING IN FUSARIUM CULMORUM. V.Balmas1, M. Dufresne2, G. Ortu1,2, M.-J. Daboussi2 and Q.Migheli1. 1Dipartimento di Protezione delle Piante, Centro inter-disciplinare di eccellenza per lo sviluppo della ricerca biotecnologicae per lo studio della biodiversità della Sardegna e dell’area mediter-ranea, Università degli Studi, Via E. De Nicola 9, 07100 Sassari,

Italy. 2Institut de Génétique et Microbiologie, Université Paris-Sud,91405 Orsay Cedex, France. E-mail: [email protected]

Crown and foot rot of wheat is an important soil-borne dis-ease caused by several species of filamentous fungi. Fusarium cul-morum (W.G. Smith) Sacc. is one of the most common incitantsof this disease worldwide and is able to produce type B tri-chothecenes. Aiming at deciphering mechanisms involved inpathogenicity and mycotoxin production of F. culmorum, we haverecently started a transposon-based mutagenesis approach toidentify genes governing these characters without an a prioriknowledge on their function. We first used the impala element,which was already shown to transpose in a wide range of As-comycete species. A collection of 300 revertant strains was gener-ated and tested for pathogenicity on wheat under glasshouse con-dition. Following two rounds of wheat assays, 7 mutants, more orless altered in pathogenicity, were identified among 175 strainswith a reinsertion event. To date, one strain has been charac-terised in detail. Loss of pathogenicity results from the insertionof impala in a region close to the 5' end of a gene encoding a pu-tative HMG Co-A reductase, a function already described as in-volved in F. graminearum pathogenicity (Seong et al. FungalGenet. Biol. 43:34-41, 2006). In parallel, a systematic recovery ofimpala insertion sites was initiated in order to determine the in-sertional preference of this transposable element. More recently,we introduced the double component mimp/impala to comparethe tagging efficiency of both systems.

Work funded by the Ministry of University and Research(PRIN 2005: Fusarium crown and foot rot of wheat: effect ofplant defense mechanisms on pathogenicity and on mycotoxinproduction).

SOILS OF A MEDITERRANEAN HOTSPOT OF BIODIVERSI-TY AND ENDEMISM (SARDINIA) ARE INHABITED BYPAN-EUROPEAN AND LIKELY INVASIVE SPECIES OFHYPOCREA/TRICHODERMA. V. Balmas1, B. Scherm1, R.Caria1, S. Fiori1, A. Marcello1, M. Komon-Zelazowska2, A.G.Kopchinskiy2, I. Druzhinina2, C.P. Kubicek2 and Q. Migheli1.1Dipartimento di Protezione delle Piante, Centro interdisciplinaredi eccellenza per lo sviluppo della ricerca biotecnologica e per lo stu-dio della biodiversità della Sardegna e dell’area mediterranea, Uni-versità degli Studi, Via E. De Nicola 9, 07100 Sassari, Italy. 2Insti-tute of Chemical Engineering, Division of Applied Biochemistryand Gene Technology, Vienna University of Technology, Getreide-markt 9/E1665, 1060 Vienna, Austria. E-mail: [email protected]

To investigate the occurrence and biodiversity of Trichodermaspp. in Sardinia (Italy), we isolated 483 strains of Hypocrea/Tricho-derma from 15 non-cultivated soils including forest, shrublands,undisturbed and extensively grazed grass steppes. Isolates werepre-screened by RAPD-PCR, and identified at the species level bysequence analysis of internal transcribed spacer regions 1 and 2(ITS1 and 2) of the rRNA gene cluster and the long intron oftranslation elongation factor 1-alpha, using oligonucleotide Bar-Code for Hypocrea/Trichoderma (TrichOKEY), sequence similarityanalysis (TrichoBLAST) and phylogenetic inferences. The majorityof the isolates were positively identified as pan-European and/orpan-global Hypocrea/Trichoderma species from sections Trichoder-ma and Pachybasium. Recovered species comprised: H. lixii/T.harzianum, T. gamsii, T. spirale, T. velutinum, T. hamatum, H.koningii/T. koningii, H. virens/T. virens, T. tomentosum, H. semi-orbis, H. viridescens/T. viridescens, H. atroviridis/T. atroviride, T.asperellum, H. koningiopsis/T. koningiopsis, and Trichoderma sp.Vd2 sensu Jaklitsch et al. (Stud. Mycol. 55: 135-177, 2006). Onlyone isolate comprised a new, undescribed species belonging to the

Journal of Plant Pathology (2007), 89 (3, Supplement), S27-S68 S29


Harzianum-Catoptron Clade. Analysis of ITS1 and 2 and tef1 se-quences, revealed one potentially endemic ITS1 allele of T. hama-tum, although this species is known from several locations in Eu-rope, Africa and North America. All other species exhibited geno-types which were already found in Eurasia or other continents.Our data show either absence or suppression of native Hypocrea/ Trichoderma diversity due to extensive colonisation of Sardinia byhighly adaptive ecological opportunistic species from Eurasian,African and Pacific Basin. This evidence documents Sardinian soilbiodiversity as vastly disturbed and therefore unshielded againstfurther environmental and anthropogenic pressure.

Work funded by the Italian Ministry of Foreign Affairs, Bürofür Akademische Kooperation und Mobilität des Österreichis-chen Austauschdienstes, Fondazione Banco di Sardegna, Univer-sity of Sassari.

IDENTIFICATION AND CHARACTERIZATION OF BACIL-LUS AMYLOLYQUEFACIENS STRAIN M123 AS A POTEN-TIAL ANTAGONIST OF PHYTOPATHOGENIC FUNGI. V.Battaglia1, G. Puopolo1, V. Cappio1, A Raio2 and A. Zoina1. 1Di-partimento di Arboricoltura, Botanica e Patologia Vegetale, Sezionedi Patologia Vegetale, Università degli Studi di Napoli “FedericoII”, Via Università, 100, 80055 Portici, Italy. 2Istituto per la Pro-tezione delle Piante del CNR, Via Università, 133, 80055 Portici,Italy. E-mail: [email protected]

Bacillus spp. are used for preventing fungal plant diseases inorganic agriculture although concern exists on the use of somespecies, such as B. cereus, since they may be associated with hu-man diseases. The spore-forming Gram-positive isolate M123, re-covered from wheat straw, was selected for its high antibiotic ac-tivity observed in the isolation plates. The identification of thisisolate was done through the analysis of its 16S rDNA sequence.The isolate belongs to the species B. amyloliquefaciens an harm-less bacterial species included in B. subtilis group. Strain M123showed strong antagonistic activity in vitro against Rhizoctoniasolani, Botrytis cinerea, Fusarium oxysporum f. sp. lycopersici andF. oxysporum. f. sp. radicis lycopersici. It produced proteases andsiderophores while no chitinolytic activity was detected in vitro.B. amyloliquefaciens strain M123 was evaluated for the protectionof tomato plantlets from R. solani, F. oxysporum. f. sp. lycopersiciand F. oxysporum f. sp. radicis lycopersici, using an in vivo assay.The severity of disease and the percentage of dead plantlets wasreduced in all cases by the presence of M123. At the same time,M123 was able to reduce the gravity of R. solani attacks to green-house-grown tomato plants. These preliminary results assess thepotential of strain M123 in the biological control of fungal dis-eases of tomato plants and represent a first step in its possible ex-ploitation in organic agriculture.

PHYTOPATHOLOGICAL PROBLEMS OF BIOMASS POPLARAND MISCANTHUS. G. Beccari and L. Covarelli. Dipartimentodi Scienze Agrarie e Ambientali, Sezione di Arboricoltura e Pro-tezione delle Piante, Area Patologia Vegetale, Università degli Stu-di, Borgo XX Giugno 74, 06121 Perugia, Italy. E-mail: [email protected]

The phytosanitary status was monitored of poplar (Populusspp.) and miscanthus (Miscanthus x giganteus Greef et Deuter)grown as energy crops in an experimental field in Umbria (cen-tral Italy). In 2006, natural late summer rust infections were ob-served on four different poplar clones which proved susceptible

to the disease, but with significant differences in disease inci-dence and severity. Poplar leaves showed the typical rusty col-oration due to the presence of many hypophyllous, less frequent-ly epiphyllous, uredinia with urediniospores. As the season pro-gressed, a high number of telia with teliospores appeared on bothleaf surfaces. Microscopic observations of the morphologicalcharacteristics of urediniospores and teliospores and of infectedleaf sections and a statistical cluster analysis of spore size revealedthat the attacks were caused by two rust species, Melampsora lari-ci-populina and M. allii-populina. In May 2007, miscanthus rhi-zomes coming from experimental field plots showing a very lowemergence and a soft and dry rot, with brownish and necrotic tis-sues, were examined. Isolation on PDA and microscopic observa-tions showed that Fusarium spp. and Rhizopus spp. were consis-tently associated with diseased material with an incidence of 70%and 55%, respectively. Pathogenicity tests are in progress.

Work carried out within the project “Analisi e valutazione diordinamenti produttivi alternativi nelle aree di riconversione deltabacco” (Co.Al.Ta. 2) funded by the EU and the Ministero perle Politiche Agricole, Alimentari e Forestali.

PLEOSPORA ALLII AGENT OF WILTING AND ROTTINGON RADISH PLANTLETS IN ITALY. A. Belisario1, S. Talevi2,S. Vitale1, L. Luongo1, S. Nardi2 and F. Corvi2. 1CRA, IstitutoSperimentale per la Patologia Vegetale, Via C.G. Bertero 22, 00156Roma, Italy. 2Agenzia Servizi Settore Agroalimentare Marche(ASSAM), Via Alpi 21, 60131 Ancona, Italy. E-mail: [email protected]

Pleospora allii (anamorph Stemphylium vesicarium) is apolyphagous fungal pathogen particularly harmful to succulentorgans. In Italy, it is common on Allium spp., but it has also re-ported on tomato and pear. On European pear this fungus is theagent of brown spot, a destructive disease in the Mediterraneanarea. A consistent contamination of Stemphylium sp. was detect-ed on radish seeds by seed blotter. Seeds were to be exported forsprout production to Asian markets where they are appreciatedfor human consumption. No chemical dressing was allowedagainst seed-borne pathogens or contaminants. Stemphylium vesi-carium was identified on the basis of morphological characters ofconidia and conidiophores. Species identification was also sup-ported by ITS (accession Nos. AM 746020 to AM746023) andgpd sequence comparison. Pathogenicity tests were carried out onsprouts grown in infested soil, and on plantlets at the 1st-2nd trueleaf stage by spraying a conidial suspension. Epicotyl darkeningand rotting and root rotting developed on sprouts, while wiltingand death occurred on infected young plants. The pathogenreisolated from the inoculated plants was morphologically identi-cal to the original isolates, which confirmed S. vesicarium as thecausal agent. To our knowledge this is the first report of S. vesi-carium as agent of wilting and rotting of radish plantlets in Italy.

DETECTION OF ATYPICAL STRAINS OF CLAVIBACTERMICHIGANENSIS SUBSP. MICHIGANENSIS IN GREEN-HOUSE TOMATOES IN SICILY. P. Bella1,2, G. Ialacci1, G. Lic-ciardello1,2, and V. Catara1 1Dipartimento di Scienze e TecnologieFitosanitarie, Università degli Studi, Via S. Sofia 100, 95123 Cata-nia, Italy. 2Parco Scientifico e Tecnologico della Sicilia, Zona Indu-striale, Stradale G. Agnelli angolo V. Lancia, 95030 Catania, Italy.E-mail: [email protected]

In the last two years, tomato samples from plastichouses of Ra-



gusa (Sicily’s most important tomato growing area) have beenanalysed in our laboratories. Symptoms typical of bacterial cankerwere found: wilting of the upper leaves, yellow to brown discol-oration of vascular tissues, cankers on stem and cavities in thepith. Thus, the samples were subjected to the analyses describedin the EPPO diagnostic protocol for Clavibacter michiganensissubsp. michiganensis (Cmm). Gram positive colonies morphologi-cally similar to Cmm were isolated from discoloured vascular tis-sue. Preliminary identification of isolates from two farms by PCRwith CMM5/CMM6 specific primers failed, as did direct PCRanalyses on infected tissues. Nevertheless the PCR-negative strainswere identified as C. michiganensis subsp. michiganensis by partial16S rRNA sequence analysis, Microlog database and agglutinationwith specific antiserum (Kit Express, Adgen). We tested strainpathogenicity to tomato plants (cv. Roventa), since Cmm avirulentstrains lacking the pat-1 gene on which the PCR assay is targetedhave been reported. All strains were virulent when inoculated totomato plants and within 10-15 days induced unilateral leaf wilt-ing just above the inoculation point, stem cankers and brown dis-coloration of vascular tissues. The lack of a PCR product with P1-rep/P3-rep primers to amplify the repetitive pat-1-rep motif locat-ed downstream of pat-1 further supports the absence of this gene.

GLUCOSE, FRUCTOSE AND SACCHAROSE METABOLISMIN DIPSACUS SILVESTRIS INFECTED BY CUCUMBER MO-SAIC VIRUS. M.G. Bellardi1, A. Benni1, S. Davino2, S. Grandi3,M. Davino2 and R. Piccaglia3. 1Dipartimento di Scienze e Tecnolo-gie Agroambientali, Sezione di Patologia Vegetale, Alma Mater Stu-diorum, Università degli Studi, Via G. Fanin 42, 40127 Bologna,Italy. 2Dipartimento di Scienze e Tecnologie Fitosanitarie, Sezionedi Patologia Vegetale, Università degli Studi, Via S. Sofia, 100,95123 Catania, Italy. 3Dipartimento di Scienze e TecnologieAgroambientali, Sezione di Agronomia, Alma Mater Studiorum,Università degli Studi, Via G. Fanin 44, 40127 Bologna, Italy. E-mail: [email protected]

Dipsacus silvestris Miller (or Fuller’s Teasel) (Dipsacaceae) show-ing stunting, chlorotic leaf mosaic and narrowing of the leaf blades,was found naturally infected by Cucumber mosaic virus (CMV) forthe first time in Italy. This virus was detected by PAS-ELISA andmolecularly characterized by RT-PCR using specific primers for themovement protein gene of RNA-3 (forward 5' CTAGGCTTTC-CAAGCTACAG 3'; reverse 5' CTAAAGACCGTT AACCACCT-GC 3'). The content of glucose, fructose and saccharose, deter-mined by HPLC analysis, was calculated in both healthy (h) andCMV-infected (i) D. silvestris plants during the chronic infectionperiod. An higher content of these carbohydrates was observed inhealthy leaves and roots: 5.57% (h) and 1.98% (i) in the leaves;12.47% (h) and 6.49% (i) in the roots. In particular, roots ofCMV-infected plants, had a significantly lower glucose level (5%)than roots of healthy plants (8,73%), A similar behaviour wasshown by fructose content (1.5% in infected roots and 3.35% inthe healthy ones). These results tally with previous reports indicat-ing that, in virus-infected plants, decreased phytosyntetic activitycoupled with increased respiratory rate, produce lower carbohy-drate concentration. Considering that some of the most importantcomponents of D. sylvestris, a medicinal plant, are glucosides (i.e.,scobioside), determination of sugar content, in particular glucoselevel, can be useful for the market value of the drug.

SURVEY OF VIRUS DISEASES OF POLYGALA MYRTIFOLIAIN LIGURIA. M.G. Bellardi1, A. Benni1, S. Davino2, M. Davino2

and G. Bozzano3. 1Dipartimento di Scienze e Tecnologie Agroam-

bientali, Sezione di Patologia Vegetale, Alma Mater Studiorum, Uni-versità degli Studi, Via G. Fanin 42, 40127 Bologna, Italy. 2Diparti-mento di Scienze e Tecnologie Fitosanitarie, Sezione di di PatologiaVegetale, Università degli Studi, Via S. Sofia 100, 95123 Catania,Italy. 3Società Cooperativa L’Ortofrutticola, Via Dalmazia 169,17031 Albenga (SV), Italy. E-mail: [email protected]

Polygala myrtifolia L. (myrtle-leaf milkwort; Polygalaceae) is anattractive evergreen shrub, originating from South Africa, recentlyintroduced in Liguria (northern Italy) where it is propagated bycuttings. In 2006, severe virus-like symptoms consisting of leafmosaic, narrowing of the leaf blades, yellow spots, vein yellowing,white necrotic spots, rings and line-patterns on oldest leaves andvariegation on younger leaves, were observed on plants growing indifferent nurseries in the Imperia province. No flower symptomswere observed. Since in 2002 Polygala was reported in Italy as anew natural host of Cucumber mosaic virus (CMV), preliminaryPAS-ELISA tests were carried out to check for the presence ofthis virus. CMV alone was detected in association with chloroticmosaic symptoms. In plants showing yellow veins and spots, po-tyvirus-like filamentous particles were observed under the elec-tron microscope. In IEM (“decoration”) and PAS-ELISA tests,this virus proved to serologically related distantly to Soybean mo-saic virus and strongly to Bean yellow mosaic virus. P. myrtifoliashowing rings and line-patterns was positive (PAS-ELISA) to theBatavian lettuce strain of Tomato spotted wilt virus (TSWV: PVAS-450; American Type Culture Collection, Manassas, VA, USA). RT-PCR was done using specific primers for the CP gene of TSWV(forward 5'-TTA ACT TAC AGC TGC TTT-3'; reverse 5'-CAAAGC ATA TAA GAA CTT-3'). All samples yielded DNA frag-ments of the expected size (823 bp). Considering that in 1940 wildPolygala in South Africa was reported as a probable host oftospoviruses (unconfirmed report), our study establishes P. myrti-folia as a new natural host for TSWV.

SURVEY OF VIRUS DISEASES OF RANUNCULUS HYBRIDSIN LIGURIA. M.G. Bellardi1, P. Restuccia2, M. Zanini1 and V.Vicchi3. 1Dipartimento di Scienze e Tecnologie Agroambientali, Se-zione di Patologia Vegetale, Alma Mater Studiorum, Università degliStudi, Via G. Fanin 42, 40127 Bologna, Italy. 2Cooperativa Rivieradei Fiori, Regione Prati e Piscine, 18011 Arma di Taggia (IM), Italy.3Servizio Fitosanitario Regione Emilia-Romagna, Via di Corticella133, 40129 Bologna, Italy. E-mail: [email protected]

In 2005-2006, two hundred samples of Ranunculus hybridscollected in the Sanremo area (Liguria, northern Italy) were ex-amined for the presence of viruses associated with severe symp-toms on the leaves (chlorosis, mosaic, “parsely-like” appearance,vein-yellowing, necrotic spots and rings), flowers (colour break-ing, malformations) and/or with premature death of the plants.Through mechanical inoculations to herbaceous plants, electronmicroscopy (“leaf-dip”), DAS and PAS-ELISA, IEM (“decora-tion”), and RT-PCR, virus particles of different length (from 700to 800 nm) and diameter (from 30 to 90-100 nm) were detectedsingly or in mixed infections. Cucumber mosaic virus (CMV),alone in a few cases, more frequently in mixture with Tomatospotted wilt virus (TSWV) occurred in plants showing leaf mosa-ic, necrosis, stunting and severe symptoms on the flowers. BothTSWV and Impatiens necrotic spot virus (INSV), in some cases inassoaciation with the Ranunculus strain of Potato virus Y (PVY-R), were detected in plants characterized by mosaic, necrosis and“parsely-like” apperance of the leaves. Turnip mosaic virus(TuMV) and other unidentified potyvirus-like viruses were alsoencountered. CMV and all potyviruses prevailed in Autumn 2006possibly as a consequence of the heavy aphid infestations. Our



resaults clearly show not only that different virus species arewidely present in Ranunculus crops in the Sanremo area, but alsothat a correlation between symptom expression and infectingvirus is very difficult to establish. Considering the increased eco-nomic damages to cut flower production recently observed, con-trol measures to prevent virus spreading are required.

TOSPOVIRUSES INFECTING RUSCUS RACEMOSUS(DANAE RACEMOSA) IN LIGURIA. M.G. Bellardi1, V. Vicchi2,A. Benni1 and P. Restuccia3. 1Dipartimento di Scienze e Tecnolo-gie Agroambientali, Sezione di Patologia Vegetale, Alma Mater Stu-diorum, Università degli Studi, Via G. Fanin 42, 40127 Bologna,Italy. 2Servizio Fitosanitario Regione Emilia Romagna, Via di Cor-ticella 133, 40129 Bologna, Italy. 3Cooperativa Riviera dei Fiori,Regione Prati e Piscine, 18011 Arma di Taggia (IM), Italy. E-mail:[email protected]

Ruscus racemosus (Danae racemosa) is an ornamental specieswith decorative foliage whose branches are used in flowerarrangements. In the Ligurian Riviera (northern Italy) this shrubis cultivated on a surface of 330 ha and the cut foliage producedis almost all exported to Europe and the United States. In 2005-06, surveys of R. racemosus crops in the Sanremo area, revealeddifferent types of leaf symptoms consisting of concentric yellowand necrotic rings, necrotic spots (from a few mm to ca 1 cm insize), necrosis and bronzing of the leaf lamina. In 2005, the per-centage of diseased plants showing necrotic rings in the openfield was about 60-70%; similar percentages of symptomaticplants were also observed in 2006. Preliminary electron micro-scope observations (“leaf dip”) did not show the presence of fila-mentous virus particles. Considering that ten years ago Impatiensnecrotic spot virus (INSV) was found infecting D. racemosa inPortugal (Louro D., Acta Hortic. 431: 99-105, 1996), testing byDAS and PAS-ELISA and RT-PCR was done to check the pres-ence of tospoviruses. Single infections by Tomato spotted wiltvirus (TSWV) and INSV were detected in plants showing necro-sis and spots on the leaves. However, when in mixed infection,these viruses were associated with the other types of leaf symp-toms described, and to premature death of the plants. This sur-vey confirms once again the great variability of symptoms in-duced by tospoviruses in ornamental species and that theirspreading in Liguria is increasing.

CONTROL OF QUARANTINE DISEASES IN EMILIA RO-MAGNA: THE CASE OF PEACH MOSAIC VIRUS. L. Bianchi1,A. R. Babini2, C. Ratti1, A. Pisi1, G. Filippini1, V. Vicchi2, L.Giunchedi1 and C. Rubies Autonell1. 1Dipartimento di Scienze eTecnologie Agroambientali, Sezione di Patologia Vegetale, AlmaMater Studiorum, Università degli Studi, Viale Fanin 40, 40127Bologna, Italy. 2Servizio Fitosanitario Regione Emilia Romagna,Via di Corticella 133, 40129 Bologna, Italy. E-mail: [email protected]

In Italy, quarantine pest controls on plant material introducedfrom non UE countries are in charge of the Regional Plant Pro-tection Service (D.L.214/2005) which collaborates with accredit-ed laboratories whenever the need arises. In 2006, three peachplants, obtained from budsticks of accession 32-3 imported inEmilia-Romagna from the United States, and maintained in aquarantine screenhouse, showed in spring a chlorotic yellow mot-tling of the leaves which did not match symptoms induced byviruses known in Europe. Following graft inoculation, the indica-tor GF 305 showed leaf symptoms similar to those described

above. Leaf dip observations by electron microscope of samplescollected from infected GF 305, showed the presence of filamen-tous virus particles morphologically similar to those of the tri-choviruses Peach mosaic virus (PcMV), a quarantine pest report-ed in EPPO list (Annex 1) and in D.L. 214/2005 (Annex 1, A, 1)and Cherry mottle leaf virus (CMLV). RT-PCR assays using PcMVspecific primers yielded amplicons of the expected size. A se-quence of 2.3 kbp, corresponding to the 3' region of the PcMVand CMLV genome was subsequently obtained from the PCR-amplified products which shared 87% and 72% identity withpublished sequence of PcMV and CLMV, respectively, confirm-ing the presence of PcMV in imported budsticks. The case ofPcMV confirms the efficient interaction of the Regional PlantProtection Service and scientific laboratories capable of handlingadvanced diagnostic tools, in preventing the introduction anddissemination of quarantine pests.

BIOLOGICAL CONTROL OF CITRUS GREEN MOULDWITH PSEUDOMONAS SYRINGAE. A. Bonaccorsi and G.Cirvilleri, Dipartimento di Scienze e Tecnologie Fitsanitarie,Sezione di Patologia Vegetale, Università degli Studi, Via S. Sofia100, 95123 Catania, Italy. E-mail: [email protected]

Pseudomonas syringae strains were tested for their antagonisticproperties to control the post-harvest pathogen Penicillium digi-tatum. Several strains and their culture filtrates reduced thegrowth of the pathogen in in vitro assays. The incidence andseverity of green mould on lemons (Citrus lemon Burm cv. Fem-minello) and oranges (Citrus sinensis Osbeck cv. Tarocco) wereconsistently reduced when antagonists were co-inoculated in cit-rus wounds with the pathogen. One of the most active strain, P.syringae 48SR2, was genetically tagged with the promoterless luxoperon Tn4431 to monitor population dynamics in vivo. Fourhundred thirteen mutants were obtained and diverse biolumines-cent activities were observed according to the insertion ofTn4431 into a wide variety of regions of the chromosome. A se-lected strongly bioluminescent mutant (lux 176) and the wild-type strain equally reduced the growth of P. digitatum in vitro andthe severity and incidence of citrus decay in vivo. Population sizeof both wild-type and lux-mutant strains, followed over time withdilution plating techniques and with bioluminescence detectionsystems, remained similar over 1 week in citrus wounds. Theseresults indicate that P. syringae strain 48SR2 could be considereda biological control agent for citrus green mould and that biolu-minescence can be a sensitive detection method to study popula-tion dynamics and antagonistic behaviour during fruit storage.

SOIL AMENDMENT WITH CROP RESIDUES, ORGANICWASTE, COMPOST AND PEAT FOR THE CONTROL OFSOIL-BORNE FUNGAL PATHOGENS. G. Bonanomi, V. Anti-gnani, C. Pane and F. Scala. Dipartimento di Arboricoltura, Bota-nica e Patologia Vegetale, Sezione di Patologia Vegetale, Universitàdegli Studi di Napoli “Federico II”, Via Università 100, 80055 Por-tici (NA), Italy. E-mail: [email protected]

The utilization of organic matter (OM) has been proposed,both for conventional and biological agricultural systems, to de-crease the incidence of plant diseases caused by soil-bornepathogens. In this work we reviewed the literature on the sup-pressive capacity of different OM materials and the response ofdifferent soil-borne pathogens to OM amendments. A total of252 articles were included in the analysis, with 1964 experimentalstudy cases. The effect of OM amendments was suppressive in



45% and non-significant in 35% of the cases, respectively. In20% of the cases, a significant increase of disease incidence wasobserved. Compost was the most suppressive material, with morethan 50% of the cases with effective disease control. Activity ofcrop residues was more variable. Disease incidence was sup-pressed in 45% but enhanced in 28% of the cases. Finally, a sig-nificant disease suppression with peat was recorded only in 4%of the experiments. OM suppressivity largely varied with differ-ent pathogens: it was observed in more than 50% of the cases forVerticillium, Thielaviopsis, Fusarium, Phytophthora and Pythium.In contrast, an effective control of Rhizoctonia solani wasachieved only in 26% of the cases. From this review it emergesthat application of OM amendments has a great potential but, atthe same time, it presents some inconsistencies. Further investiga-tions on the mechanisms by which OM acts on disease suppres-sion are needed to make the use of these materials predictable.

EFFECTIVENESS OF SOIL SOLARIZATION WITHBIODEGRADABLE MATERIALS AND IMPACT ON THESOIL MICROBIAL COMMUNITY. G. Bonanomi1, M. Chiu-razzi2, G. Del Sorbo1, G. Moschetti3 and F. Scala1. 1Dipartimentodi Arboricoltura, Botanica e Patologia Vegetale, Sezione di Patolo-gia Vegetale, Università degli Studi di Napoli “Federico II”, ViaUniversità 100, 80055, Portici (NA), Italy. 2Dipartimento di Scien-za degli Alimenti, Università degli Studi di Napoli, Via Università100, 8005 Portici (NA), Italy. 3Dipartimento di Scienze Entomo-logiche, Fitopatologiche, Microbiologiche e Zootecniche, Universitàdegli Studi, Viale delle Scienze 2, 90128 Palermo, Italy. E-mail: [email protected]

The increasing concern about the impact of mineral fertilizers,fungicides and herbicides on the environment and human healthrequires the development of alternative agronomic techniquesthat may reduce the use of these products. Soil solarization,based on the use of plastic sheets to increase soil temperature,seems one of the most promising techniques for the control ofsoil-borne pathogens. However, an important limitation to thediffusion of this technique comes from the drawbacks regardingthe disposal of the used plastic materials. A possible solution tothis problem may be found in the use of biodegradable plastics.These materials degrade gradually when plowed-down in the soilbecause of microorganism activity. The aim of this study was tocompare the impact of soil solarization with plastic films andbiodegradable materials on crop productivity, soil-borne diseaseincidence, weed suppression, and soil chemical and microbial pa-rameters. We carried out field experiments on two types of soilwith different textures (clay and sandy) located in southern Italy,which were artificially inoculated with Fusarium oxysporum f. sp.lycopersici and Sclerotinia minor. The results showed the potentialof the use of the biodegradable solarizing materials in place ofplastic films, but indicate the need to improve their properties toafford performances comparable to those of other pest manage-ment techniques.

FUNGAL ENDOPHYTIC COMMUNITIES DETECTED IN DE-CIDUOUS OAK TREES FROM SOUTHERN ITALY. E. Boncal-do, G. Sicoli, F. Mannerucci and N. Luisi. Dipartimento di Biolo-gia e Patologia Vegetale, Università degli Studi, Via Amendola165/A, 70126 Bari, Italy. E-mail: [email protected]

In four oak woods located in different regions of southernItaly, a study was carried out focusing on the composition and sea-sonal variation of fungal endophytic communities inhabiting epi-

geous tissues of healthy and declining trees of Quercus pubescensWilld. and Q. cerris L. In total, 17 fungal taxa were detected in-cluding potentially pathogenic organisms, many of which wereagents of bark necrosis, as well as indifferent or probable antago-nists. The most common pathogen was Discula quercina (West)von Arx, that has an isolation frequency (IF) of 10.7% and occu-ured in both oak species, more specifically in buds, followed byBiscogniauxia mediterranea (De Not.) O. Kuntze (IF = 5.4%),which was prevalent in leaves and bark, and Diplodia corticolaA.J.L. Phillips, Alves et Luque (IF = 4.3%). Lower values of IFwere shown by Phomopsis quercina (Sacc.) Hohn and species inthe genera Cytospora and Phoma. Aureobasidium pullulans (deBary) G. Arnaud (IF = 25%) was the most common nonpatho-genic fungus, isolated primarily from the leaves. By comparing IFvalues from spring to autumn, most fungal species seemed to pre-fer autumn as the most suitable season for host tissue colonization.

DEVELOPMENT OF PCR PRIMERS FOR THE IDENTIFICA-TION OF CYLINDROCLADIUM PAUCIRAMOSUM. I. Cameleand L. Altieri. Dipartimento di Biologia, Difesa e BiotecnologieAgro-Forestali, Università degli Studi della Basilicata, Via dell’Ate-neo Lucano 10, 85100 Potenza, Italy. E-mail: [email protected]

Cylindrocladium spp. are reported worldwide as the incitantsof root and crown rot, stem canker, leaf spot and seedling andshoot blight of wild and cultivated plants. Cy. pauciramosum C.L.Schoch et Crous (teleomorph Calonectria pauciramosa) has a widehost range and attacks many ornamental plants. In southern Italy,the fungus has caused extensive losses requiring chemical controlmeasures. It was recently reported in Italy on Polygala myrtifoliaand identified on the basis of morphological characters. Howev-er, these diagnostic procedures are expensive and time consum-ing. For improving identification and detection of Cy. pauciramo-sum PCR primers CPAUCIR (GCTTTCTGGCAGACCATTTC)and CPAUCIF (TGTCAGTTGGCTTGTGCTTC) were de-signed on the sequence of the b-tubulin gene. These primers am-plified a 161pb fragment from all Cy. pauciramosum pure culturestested but failed to amplify DNA from isolates of many otherfungi or stramenopiles used as control. Specificity of the primerpair was verified by PCR assay using the annealing temperatureof 55°C. Further studies will be conducted to verify the possibili-ty to distinguish Cy. pauciramosum from closely related species(Cy. scoparium and Cy. candelabrum) by molecular methods.

STUDIES ON POST-HARVEST ORANGE ROT CONTROLWITH ESSENTIAL OILS. I. Camele1, V. De Feo2, L. Altieri1, E.Mancini2 and G.L. Rana1. 1Dipartimento di Biologia, Difesa eBiotecnologie Agro-Forestali, Università degli Studi della Basilicata,Via dell’Ateneo Lucano 10, 85100 Potenza, Italy. 2Dipartimento diScienze Farmaceutiche, Università degli Studi di Salerno, Via PonteDon Mellillo, 84084 Fisciano (SA), Italy. E-mail: [email protected]

Twelve essential oils, extracted by hydrodistillation, were test-ed at different concentrations against four fungi known to causepost-harvest rot of orange fruit, i.e. Botrytis cinerea, Penicilliumexpansum, Phytophthtora citrophthora and Mucor spp. Plantspecies used as a source of these volatile fractions were Carumcarvi, Foeniculum vulgare, Pimpinella anisum (Apiaceae), Hysso-pus officinalis, Lavandula angustifolia, Majorana hortensis, Melissaofficinalis, Ocimum basilicum, Origanum vulgare, Salviaofficinalis, Thymus vulgaris (Lamiaceae), and Verbena officinalis(Verbenaceae). Preliminary experiments carried out in vitroshowed that only essential oils from V. officinalis, T. vulgaris and



O. vulgare showed some fungistatic action against the above fun-gi. Thus, only these three essential oils were used in successive invivo tests to protect healthy orange fruits of cv. Washington fromartificial infection by the same micromycetes. Essential oil from T.vulgare at 2000 ppm controlled fruit rot by B. cinerea, P. citroph-thora and Mucor spp. but was ineffective against P. expansum. Es-sential oils from V. officinalis and O. vulgare inhibited infectionby the former couple of fungi and by P. citrophthora only, respec-tively.

MYCOFLORA ASSOCIATED WITH DURUM WHEAT KER-NELS PRODUCED IN SICILY. V. Campanella and C. Miceli.Ente Nazionale delle Sementi Elette, Viale Regione Siciliana S-E8669, 90121 Palermo, Italy. E-mail: [email protected]

The results of investigations on the mycoflora associated withdurum wheat seeds, are reported. Analyses were done on 443 du-rum wheat samples, collected in 2003-05, from conventional andorganic crops, in the main cereal growing areas of Sicily. Fungiwere isolated plating surface disinfested seeds on a semi-selectivemedia and identified on the basis of colony morfology and fruitingstructures produced on the seeds. No substantial differences wereobserved on seed-borne fungi contamination between convention-al and organic samples. Ubiquitary, saprophytic or weakly patho-genic species, among which Alternaria spp., Cladosporium spp.,Gonatobotrys spp., Nigrospora spp., Penicillium spp., Rhizopusspp. and Stemphylium spp., were found in all samples from bothcropping systems. Alternaria spp., was the most frequently isolat-ed microorganism ranging from 45.1% to 90.6% in conventionalsamples and from 36.7% to 82.0% in organic samples. A progres-sive yearly increase of pathogenic Fusarium spp. was observed. Inparticular, these pathogen occurred on 18.2%, 52.2% and 60.6%in 2003, 2004 and 2005, respectively. F. poae was the predominantspecies found in samples from both cropping systems. Seed germi-nation was not significantly affected by the presence of fungalcontaminants, being in average 91.2%, 90.9% and 91.9% in 2003,2004 and 2005, respectively. Our data show a satisfactory sanitarycondition of durum wheat kernels, characterized by the low pres-ence of the most aggressive species of Fusarium, associated withhead blight, foot rot, and seedling blight.

EFFECTS OF GRAIN LEGUMINOUS CROPS ON POPULA-TION AND GENETIC VARIABILITY OF SOIL SPORE-FORM-ING BACTERIA WITH ANTIBIOSIS ACTIVITY. F. Campanile,D. Villecco, A. Del Galdo and M. Zaccardelli. CRA, Istituto Sper-imentale per le Colture Industriali, Strada Statale 18 n. 204, 84091Battipaglia (SA), Italy. E-mail: [email protected]

Spore-forming bacteria, one of the most important group ofmicroorganisms with high antibiosis activity, are interesting forbiological control. In this work, in a soil of the Sele Valley (south-ern Italy), spore-forming bacterial populations were evaluated inMay and July 2006 during cultivation of wheat and three legumi-nous crops (pea, faba bean and chickpea) and in November, dur-ing cultivation of fennel that followed the previous crops. Sam-ples (three for each crop and time of collection) were collectedfrom the first 20 cm of soil in proximity of the roots, sievedthrough 2 mm screens and, washed for 1 h in physiological solu-tion. Ten-fold dilutions were made an aliquot of which was platedand incubated after treatment at 90°C for 10 min. The coloniescounted were purified and tested for antibiosis activity againstFusarium solani, Rhizoctonia solani, Sclerotium rolfsii, Phoma sp.and Ascochyta spp. The bacterial isolates that showed antibiosis

activity were then characterized for DNA polymorphism by M13-PCR. No difference in the number of soil spore-forming bacteriawas observed among the four crops in May, whereas their num-ber was higher (1.8 × 106 g-1 of fresh soil) from soil samples culti-vated with chickpea collected in July. A high number of spore-forming bacteria collected during cultivation of wheat, legumi-nous crops and fennel, showed antibiosis activity against the test-ed fungi. Genetic variability of these potentially antagonistic bac-teria was very high, in fact, 28 haplotypes were obtained on thewhole.

ROOT ROT DISEASE BY HETEROBASIDION ANNOSUM ONFAGUS SILVATICA STANDS IN SOUTHERN ITALY. P. Capret-ti, N. Luchi and G. Mazza. Dipartimento di Biotecnologie Agrarie,Sezione di Patologia Vegetale, Università degli Studi, Piazzale delleCascine 28, 50144 Firenze, Italy. E-mail: [email protected]

Occurrence and persistence of the root rot pathogen Heteroba-sidion annosum (Fr.) Bref. in infested areas and its transfer to dif-ferent host species was studied in different forest sites in Calabria(southern Italy). This region is characterized by annual rainfallsranging from 1500 to 1900 mm, mostly concentrated during thedormant season, the mean annual temperature is comprised be-tween 10,6 and 11,5°C and soils are mostly sandy. The sites consist-ed of adult (ca 50-60 year-old) mixed stands established with Acerplatanoides, Fagus sylvatica, and Pinus laricio planted on formerpasture or agricultural land. The investigation showed that H. an-nosum, which was present in contiguous Pinus laricio stands, wasable to persist in the root systems of pines for long time and wasable to infect nearby beech trees via root contacts and to colonizebeech stumps after occasional felling. Damage mainly consisted ofuprooting of large beech trees which is unusual for this species inItaly. Isolations from trees and stumps of different sites showedhigh frequencies of the fungus on declining trees which producedlarge carpophores on the roots and on the stumps. Infected treesoften exhibited top die-back connected with the occurrence ofBiscogniauxia nummularia ascomata on dead branches.

RHIZOCTONIA SOLANI ANASTOMOSIS GROUPS PATHO-GENIC TO WHITE LUPIN (LUPINUS ALBUS) IN CAMPA-NIA. A. Carella, E. Cozzolino and R. Nicoletti. CRA, IstitutoSperimentale per il Tabacco, Via Vitiello 108, 84018 Scafati (SA),Italy. E-mail: [email protected]

The polyphagous pathogen Rhizoctonia solani (teleomorphThanatephorus cucumeris) is a collective species including at least13 anastomosis groups (AGs). AGs 1 through 5, AG-8, AG-10and AG-11 have been reported from Lupinus spp., but so far nodefinite relationship between AG-belonging and virulence of theisolates has been established. R. solani and other soil-borne fungicausing crown and root rot represent the major phytopathologi-cal problem of white lupin in the Caserta area (souhern Italy)where this crop species has been proposed as an alternative to to-bacco. Isolates recovered from diseased plants proved to belongto AG-2-1 and AG-4, with the latter resulting more virulent ingreenhouse tests. Both AGs had been previously recovered fromtobacco in the same area, but AG-2-1 isolates were ascribed to anew infraspecific group (AG-2-1-Nt) on the account of a peculiarzymogram and low anastomosis frequency with standard AG-2-1tester isolates. Unlike AG-4 isolates, for which a substantial simi-larity in fusion frequency and pectic zymograms was observedwith isolates from tobacco and wormweed collected in the samearea, no correspondence with AG-2-1-Nt was found for AG-2-1



isolates from lupin. In fact, an equivalence of the latter to thestandard AG-2-1 tester isolates resulted in both anastomosis fre-quency and zymography. These results are at least in part indica-tive of the absence of an epidemiological role of tobacco preces-sion, and confirm Nt-isolates as a distinct and phylogeneticallydiverging grouping within AG-2-1.

EFFECTS OF PHYSICAL, BIOLOGICAL, AND INTEGRATEDCONTROL MEASURES ON THE REDUCTION OF VERTI-CILLIUM DAHLIAE SURVIVAL AND OF PYRENOCHAETALYCOPERSICI INFECTIONS. I. Castello, A. Vitale and G.Polizzi. Dipartimento di Scienze e Tecnologie Fitosanitarie, Sezionedi Patologia vegetale, Università degli Studi, Via S. Sofia 100,95123 Catania, Italy. E-mail:[email protected]

During 2006-2007, two experiments were carried out in toma-to plastic-houses in south-eastern Sicily. Trials allowed to studythe effectiveness of soil solarization treatments using innovativeplastic mulching films alone or in combination with biological an-tagonists (Trichoderma harzianum T22, T. harzianum ICC 012,and T. viride ICC 080) and amendments (Brassica juncea andBiofence). Solarization of the soil of plastic-houses with no filmcovering lasted 2 months. The survival of microsclerotia of Verti-cillium dahliae was reduced in all solarized or amended plots af-ter 22 days and 43 days treatment, respectively. The highest re-duction was obtained in soil plots solarized with the film “Fumè”and in those covered with the film “Green coextruded” in combi-nation with Brassica juncea. Solarization alone and in combina-tion with biological antagonists and amendments resulted in theeffective control of infections by Pyrenochaeta lycopersici. Solar-ization integrated with T. harzianum T22 was significantly moreeffective than the corresponding solar treatment alone. Treat-ments with biological antagonists or with amendments alone didnot reduce the severity of tomato corky rot in comparison to con-trol plots. Our results confirmed the efficacy of soil solarizationin open plastic-houses with innovative plastic films for the con-trol of corky rot infections and for reducing the survival of mi-crosclerotia of V. dahliae.

IN VIVO ANTIBIOGRAM TO TEST THE ACTION OF SYN-THETIC AND NATURAL COMPOUNDS ON PHYTOPLAS-MAS. S. Chiesa, S. Prati, G. Assante, D. Maffi and P.A. Bianco.Istituto di Patologia Vegetale, Università degli Studi, Via Celoria 2,20133 Milano, Italy. E-mail: [email protected]

With the aim of finding new strategies to control phytoplas-mal diseases, a series of natural and synthetic compounds weretested to study their activity in Catharanthus roseus L. healthy andgraft-infected with two phytoplasmas (Candidatus Phytoplasmaasteris and Candidatus Phytoplasma ulmi). A preliminary investi-gation was carried out by testing the responses of plants to treat-ment with tetracycline. The compound was applied in severalways (spraying, root absorption and scion dipping), and at differ-ent concentrations and number and timing of treatments. The re-sults obtained showed that scion dipping was the most suitablemethod in our experimental conditions, as it needed the lowestamount of compound and permitted the quantification of thecompound absorbed. Thus, this procedure was adopted to testsome natural substances never assayed before in this host-pathogen system: (i) Cercosporin, Spirolaxin and Cladosporol,organic compounds of fungal origin with alleged antibiotic activi-ty against phytopathogenic bacteria; (ii) Carvone and Pulegone,two active terpenoids of plant origin; (iii) the mineral salt Potassi-

um Alum; (iv) the synthetic basic Dienes stain and (v) a Methion-in-Riboflavin mixture. The activity of these compounds was eval-uated on the basis of phytotoxicity, symptom evolution and mi-croscope observations. This testing method is likely to provide asustainable and rational procedure for investigating the trianglehost-phytoplasma-compound. It will be adopted in further re-search to estimate the anti-phytoplasmal activity of other knownand novel chemicals, both synthetic and natural.

INTEGRATED MANAGEMENT OF MELON COLLAPSECAUSED BY MONOSPORASCUS CANNONBALLUS. G.Chilosi, R. Reda, M.P. Aleandri, M. Antonelli, L. Varvaro and P.Magro. Dipartimento di Protezione delle Piante, Università degliStudi della Tuscia, Via S. Camillo de Lellis, 01100 Viterbo, Italy. E-mail: [email protected]

In recent years melon crops in the province of Viterbo (centralItaly) were subjected to significant losses in yield and quality dueto infections by the soil-borne fungal pathogen Monosporascus can-nonballus. The objective of this 3-year field study was to evaluatedifferent management strategies for controlling this disease.Among sanitation methods, the destruction of crop residues in-cluding roots effectively reduced disease incidence. Soil treatmentswith steam contributed to disease control in the short-term, where-as, the use of soil fumigation and solarisation did not provide satis-factory results. Melon cultivars differed in terms of tolerance.Grafting proved to be an effective measure only when more toler-ant varieties were grafted on squash, whereas grafting on melonrootstocks was consistently ineffective. In recent years, chemicalresistance inducers became an attractive alternative for controllingsoil borne pathogens. Among a set of inducers tested, methyl jas-monate decreased disease incidence. Mycorrhizal fungi and antag-onistic fungi and bacteria contribute to soil fertility and crop yieldby limiting the development of pathogens and inducing resistancein plants. We have isolated from non-cultivated soils of the area, agroup of beneficial bacteria able to inhibit growth of M. cannon-ballus. The treatment of composts with local biocontrol agents mayprovide an additional tool for controlling the pathogen.

REVERSE-TRANSCRIPTION REAL-TIME PCR ASSAY TODETECT VIABLE PROPAGULES OF PHYTOPHTHORARAMORUM IN INFECTED PLANT TISSUES. A. Chimento1,2,S.O. Cacciola2 and M. Garbelotto1. 1Department of Environmen-tal Science, Policy and Management, University of California, 137Mulford Hall, Berkeley, CA 94720-3114, USA. 2Dipartimento diScienze Entomologiche, Fitopatologiche, Microbiologiche e Zootecni-che, Università degli Studi, Viale delle Scienze 2, 90128 Palermo,Italy. E-mail: [email protected]

A new reverse-transcription real-time PCR (RT-PCR) assay wasdevelopded, based on the use of mRNA as a marker to detect vi-able propagules of Phytophthora ramorum Werres, De Cock &Man in’t Veld. This method is based on the rapid degradation ofmRNA compared to DNA. New primers specific for P. ramorumwere designed in the cytochrome oxidase gene encoding subunitsI (COXI). To evaluate the specificity of the method, four isolatesof P. ramorum and reference isolates of eleven different Phytoph-thora species were tested. Sixty leaves of Californian bay laurel[Umbellularia californica (Hook. & Arn.) Nutt.] with symptoms ofsudden oak death disease from three different sites in California(USA) and sixty symptomatic leaves of Californian bay laurel col-lected in three different seasons of the year from China CampState Park (CA) were plated on PARP selective medium and test-



ed with the RT-PCR assay in comparison with a TaqMan and aSybrGreen Real-Time PCR assay, after a classical DNA extraction.Results showed that after nine days RNA of P. ramorum killed byfreeze-drying was undetectable while DNA gave a positive signal.Furthermore, differently from method based on DNA analysis,the results of the RT-PCR assay were correlated with positive iso-lations on selective media, thus indicating that the risk of PCRfalse positives can be circumvented by using this RT-PCR method.

GENE EXPRESSION PROFILING IN TOMATO PLANTS IN-FECTED BY FOUR COMBINATIONS OF CUCUMBER MOSA-IC VIRUS AND ITS SATELLITE RNAs: A MICROARRAYANALYSIS. F. Cillo1, A. Polverari2, M. Pasciuto1, D. Glissant3,M. Delledonne3 and D. Gallitelli1. 1Dipartimento di Protezionedelle Piante e Microbiologia Applicata, Università degli Studi andIstituto di Virologia Vegetale del CNR, Via Amendola 165/A,70126 Bari, Italy. 2Dipartimento di Scienze, Tecnologie e Mercatidella Vite e del Vino, Villa Ottolini-Lebrecht, 37029 San Florianodi Valpolicella (VR), Italy. 3Dipartimento Scientifico e Tecnologico,Università degli Studi, Strada Le Grazie 15, 37134 Verona, Italy. E-mail: [email protected]

An analysis of transcriptional changes in tomato plants, in-duced by the infection of Cucumber mosaic virus, alone or incombination with satellite RNA (satRNA) variants, has beenmade by microarray analysis. The analysis was performed on thenewly developed CombiMatrix platform at the University ofVerona, on a tomato chip carrying 20200 specific probes in quad-ruplicates from assembly of Tentative Consensus of the lastTomato Gene Index (LeGI), release 11.0 (June 21, 2006). TheCombiMatrix CustomArray TM technology is characterized by anexclusive in situ oligo (up to 40 mers) synthesis driven by electro-chemistry and by the reusability of the same microarray chip, allfactors that confer high flexibility to the system and reduce re-markably the costs of microarray analysis. Tomato plants cv.UC82 were infected with the aggressive strain CMV-Fny andthree more strains, in which CMV-Fny was associated with threedifferent satRNAs (benign variant: CMV-Fny/Tfn-satRNA; stunt-ing variant: CMV-Fny/TTS-satRNA; necrogenic variant: CMV-Fny/77-satRNA). Mock-inoculated plants were used as negativecontrols. Gene expression was examined at 2 and 9 days post in-oculation, to analyse transcriptional changes associated with thedifferent disease phenotypes in both locally and systemically in-fected leaf tissues. Hybridisations were carried out with samplesderiving from three independent biological replicates. Differen-tially expressed genes were selected and analysed using the multiexperiment Significance Analysis of Microarray test, and geneclustering was performed using Genesis software. This is the firsttime that the CombiMatrix platform for microarray analysis hasbeen applied to the study of tomato-virus interactions.

POTATO VIRUS Y-LF, A PUTATIVE NEW RECOMBINANTPVY ISOLATE. S. Comes, P. Tarantino, R. Pacella, A. Fanigliuloand A. Crescenzi. Dipartimento di Biologia, Difesa e BiotecnologieAgro-Forestali, Università degli Studi della Basilicata, Via dell’Ate-neo Lucano 10, 85100 Potenza, Italy. E-mail: [email protected]

Serious symptoms of leaf necrosis, necrotic mottling alongleaflet veins, rachis distortion and irregular fruit ripening wereobserved in tomato idroponics in Calabria (southern Italy) in thelast five years. Preliminary serological tests associated these symp-toms with infection by Potato virus Y (PVY). The virus was iso-

lated on Nicotiana tabacum “Xanthi” and characterised biologi-cally by mechanical inoculation to several herbaceous hosts. Mol-ecular characterisation was performed by the amplification,cloning and sequencing of two genomic regions: P1 and coat pro-tein (CP). The identity of the virus was ascertained with mono-clonal antibodies (Mab) specific for PVYN, PVYO and PVYC: theisolate reacted only with the PVYC -specific Mab. Immuno cap-ture reverse transcription polymerase chain reaction (IC-RT-PCR) was carried out on TNA extracted from PVY-LF infectedplants, using two couples of primers specifically designed on theP1 and CP of other fully sequenced PVY isolates. PCR productsof the expected size were directly cloned into a vector and se-quenced. Analysis of P1 and CP coding regions suggests thatPVY-LF originated from a putative recombination event betweena virus of the PVYO type and another parental virus, maybe aPVYNP isolate, because of the high similarity shared by PVY-LFwith “non potato” PVY isolates in the CP coding region andPVYO isolates in the P1 coding region.

USE OF ANTAGONISTIC MICROORGANISMS FOR THECONTROL OF FUSARIUM SEEDLING AND HEAD BLIGHTOF BREAD WHEAT. L. Covarelli, M. Quaglia, E. Pannacci, G. Beccari and C. Cappelli. Dipartimento di Scienze Agrarie eAmbientali, Università degli Studi, Borgo XX Giugno, 74, 06121Perugia, Italy. E-mail: [email protected]

In 2006 and 2007 the effect of several antagonists in laboratoryand field experiments against Fusarium seedling blight and Fusar-ium head blight were carried out in the province of Perugia (Um-bria, central Italy). After soil inoculation with mycelium of Fusari-um graminearum and F. culmorum grown on PDA, seed dressingtreatments with Pseudomonas clororaphis, Trichoderma viride,Bacillus subtilis, a commercial hypovirulent strain of F. oxysporumand a commercial mixture of bacteria, mycorrhizae and Trichoder-ma spp., were compared in the laboratory with chemical seeddressing treatments with carboxin+maneb and triticonazole+guazatine. One day before head inoculation with a F. culmorumspore suspension at mid anthesis, Trichoderma viride, Bacillus sub-tilis, F. oxysporum, Ampelomyces quisquialis and T. harzianum,were sprayed in the field, on wheat plots and compared withchemical treatments with prochloraz+propiconazole and azoxys-trobin. Results showed that all the utilised antagonists did not givea satisfactory control of Fusarium seedling and head blight incomparison with chemical treatments. However, the pedo-climaticcharacteristics of the experimental areas were not favourable tonatural infections, as shown in other host-pathogen combinations(i.e., barley-Ustilago nuda, linseed-Alternaria linicola, etc.). There-fore, in some areas of Umbria, a satisfactory prevention of the dis-eases in question for production of healthy wheat seed in organicfarming, could be afforded by sowing pathogen-free seed and bydecreasing fungal inoculum with agronomic practices, such ascrop rotation with non-host species and soil tillage.

Research funded by the Regione Umbria, project PRIS2“Azioni di innovazione e ricerca a supporto del piano sementiero”.

HORIZONTAL GENE TRANSFER FROM GENETICALLYMODIFIED TOMATO PLANTS TO PSEUDOMONAS SY-RINGAE pv. TOMATO AND RALSTONIA SOLANACEARUM. L.Cozzolino1, A. Zoina1 and. A. Raio2. 1Dipartimento di Arbori-coltura, Botanica e Patologia Vegetale, Sezione di Patologia Vege-tale, Università degli Studi di Napoli “Federico II”, Via Università100, 80055 Portici (NA), Italy. 2Istituto per la Protezione delle



Piante del CNR, Via Università, 133, 80055 Portici, Italy. E-mail:[email protected]

Since antibiotic resistance markers are most frequently usedfor plant transformation, there is considerable concern about thepossibility that these genes are transferred from transgenic plantsto bacteria. In fact, bacteria that have developed a state of com-petence, may integrate foreign DNA into their genome by naturaltransformation and then express the newly acquired genes. Toappraise the possibility that recombinant DNA will be trans-ferred from genetically modified (GM) tomato plants toPseudomonas syringae pv. tomato and Ralstonia solanacearum,both bacteria were first made competent to recombination, thentransformed by inserting two different broad host range plasmidscontaining a deleted nptII genes into the cells. For these experi-ments transgenic tomato plants (cv. BetterBoy) transformed withprosystemin c-DNA and with nptII as gene marker were used.Restoration of 317 bp deleted nptII gene in Pseudomonas syringaepv. tomato (pBBRiTp DnptII) was detected, with extremely lowfrequency, after experiments of filter transformation with DNAfrom GM tomato plants conferring Kanamycin resistance. Nokanamycin-resistant transformants were detected for Ralstoniasolanacearum (pLaf DnptII). Probably this species did not devel-op DNA uptake competence under our experimental conditions.These preliminary results suggest that horizontal gene transfermay occur if homologous sequences are present both in the plantgenome and in the phytopathogenic bacterium DNA.

HETEROBASIDION ANNOSUM IN THE NATIONAL PARKOF CIRCEO. L. D’Amico, M. Scirè, T. Annesi and E. Motta.CRA, Istituto Sperimentale per la Patologia Vegetale, Via C.G.Bertero 22, 00156 Roma, Italy. E-mail: [email protected]

During a survey for Heterobasidion annosum in central Italy,ten infection centres were investigated in Pinus pinea stands ofthe Circeo national park. Basidiocarps or mycelia were collectedand airborne spores were trapped. The identification of the fun-gal isolates (about 200) was based on the taxon-specific size ofthe introns in the ML5-ML6 DNA region of the mitochondriallarge ribosomal RNA (mtLrRNA). Sequence analyses for the nu-clear elongation factor 1-a were also made in a sub-sample ofhomokaryotic isolates. Isolates identified in six infection centreswere assigned to the Eur-P group, and to the NAm-P group infour centres. Mitochondrial introns of two size are known (1.5 kband 1.8 kb) in isolates collected in North American forests, re-gardless of the geographical origin. By contrast, until now, all theNAm-P isolates collected in central Italy and studied by usshowed the presence of the 1.5 kb intron only. It was thereforesupposed that the Italian NAm-P population originated by a sin-gle introduction from North America. However, a group of wind-borne spores collected in the Circeo national park showed a 1.8kb mitochondrial intron, whose sequence is not homologous withthat of the 1.5 kb intron. Since mitochondrial DNA have an uni-parental origin, this new record was taken as evidence that atleast two separate introductions have taken place. NAm-P H. an-nosum is causing heavy damage in the park, especially in dry ar-eas, such as the coastal dunes with Juniperus spp. and dunes withPinus pinea and/or Pinus pinaster.

A NEW METHOD FOR DETECTING VIRUSES THAT CAUSETOMATO YELLOW LEAF CURL DISEASE IN THE MEDITER-RANEAN REGION AND THEIR RECOMBINANTS. S. Davino1,M. Davino1 and G.P. Accotto2 .1Dipartimento di Scienze e Tecnolo-

gie Fitosanitarie, Sezione di Patologia Vegetale, Università degli Stu-di, Via S. Sofia, 100, 95123 Catania, Italy. 2Istituto di Virologia Vege-tale del CNR, Strada delle Cacce 73, 10135 Torino, Italy. E-mail:wdavinonict.it

In the Mediterranean basin two viruses have been associatedwith epidemics of tomato yellow leaf curl disease (TYLCD), i.e.Tomato yellow leaf curl virus (TYLCV) and Tomato yellow leafcurl Sardinia virus (TYLCSV) in the last two decades. Both virus-es belong to the genus Begomovirus, family Geminiviridae. In thelast five years, interspecific hybrids between TYLCV andTYLCSV, also known as recombinants, have been described inSpain, where the two species have coexisted for several years.Both species are currently present in tomato fields also in otherMediterranean countries, including Italy. This creates ideal condi-tions for recombinants to appear and spread, so new methods fordetecting all viruses present in the region are necessary. We havedeveloped a multiplex PCR/RFLP protocol that amplifies the in-tergenic region of the genome of all TYLCSV and TYLCV iso-lates known, including interspecific hybrids. After PCR, the sam-ple is digested with Psp1406I restriction enzyme, which yieldsDNA fragments of specific size (800 to 410 bp) for each virusspecies and each recombinant. This new method gives, with a sin-gle reaction, an overview of the species present in the sample andwill be useful for screening the causal agents of TYLCD, as wellas in breeding programs for resistance.

Research supported by the MiPAAF in the framework of theproject PROM.

YELLOWING VIRAL DISORDER IN TOMATO: OCCUR-RENCE OF TOMATO INFECTIOUS CHLOROSIS VIRUS INSICILY. S. Davino1, M. Meneghini2, C. Boccongeli3, G. Di Mod-ica3 and L. Tomassoli2. 1Dipartimento di Scienze e Tecnologie Fi-tosanitarie, Sezione di Patologia Vegetale, Università degli Studi,Via S. Sofia 100, 95123 Catania, Italy. 2CRA, Istituto Sperimentaleper la Patologia Vegetale, Via C.G. Bertero 22, 00156 Roma, Italy.3Seminis Vegetable Seeds Italia. E-mail: [email protected]

The yellowing viral disorder of tomato, consisting of inter-veinal leaf mottling and yellowing, is associated with two white-fly-transmitted viruses belonging to the genus Crinivirus, familyClosteroviridae. Tomato infectious chlorosis virus (TICV) was thefirst causal agent of this disease to be characterized, followed byTomato chlorosis virus (ToCV) identified as a distinct species.Whereas TICV is transmitted by Trialeurodes vaporariorum, threespecies, Bemisia tabaci, T. abutilonea and T. vaporariorum, arevectors of ToCV. ToCV has been reported in Sicily since 2001but, even though T. vaporariorum is widespread in Sicily, TICVhad not been detected so far. In spring 2007 different tomatosamples, showing interveinal yellowing of older leaves, combinedwith thickening and brittleness, were collected in several green-houses in the province of Ragusa and analyzed for virus identifi-cation. Total RNA was extracted from leaf tissue and screened byRT-PCR for the presence of both ToCV and TICV using primersets specific for the HSP70 gene. A fragment of the expected sizeof ca 500 bp was obtained with TICV primers from samples fromdifferent greenhouses. Virus identification was also confirmed bynucleotide sequence and analysis using the BLAST programme.The virus was found either in single infection or together withToCV. The presence of TICV aggravates the phytosanitary statusof greenhouse tomato production in Sicily which is already affect-ed by other economically important disease.

Research supported by MiPAAF in the framework of the proj-ect PROM.



OBSERVATIONS ON THE RAPID SPREAD OF SEVERE ISO-LATES OF CITRUS TRISTEZA VIRUS BY APHIS GOSSYPII.S. Davino1, G. Sorrentino2, M. Guardo2, M. Davino1 and A.Caruso2. 1Dipartimento di Scienze e Tecnologie Fitosanitarie, Uni-versità degli Studi, Via S. Sofia 100, 95123 Catania, Italy. 2CRA, Istituto Sperimentale per l’Agrumicoltura, Corso Savoia 190, 95024Acireale (CT), Italy. E-mail: [email protected]

The discovery of a large focus of Citrus tristeza virus (CTV) inSicily has allowed to process a prediction model of CTV spread-ing at Baé in the province of Catania. Investigations were carriedout in three different groves of sweet orange cv. Tarocco O.L.grafted on sour orange. All trees in each grove were sampledyearly in May and September from 2002 to 2007. Four young api-cal shoots were collected from each tree and analyzed by DAS-ELISA and DTBIA. Molecular tests, SSCP and sequencing ofP20 and P23 genes, showed that the viral isolates present in thesegroves belonng to the seedling yellow strain (CTV-DS2). Moni-toring of aphid population in all plots confirmed the results re-ported in preceding works, indicating that Aphis gossypii Gloverrepresented 85-90% of the aphid population. Our results aboutthe percentage infected trees are very similar to nonlinear predic-tive model estimation of CTV spread, reported from other citrusareas where the vector is A. gossypii until the 7th-8th year from thebeginning of infection. However, after eleven years the percent-age of infected trees in all plots in our nonlinear prediction modelwas ca 98%, a figure which, elsewhere, is reached in the 14 th -15th year. This more rapid spreading of CTV in Sicily, just after the8 th year of infection, may depend on the severe CTV isolate pres-ent (seedling yellow) combined with the high susceptibility ofTarocco O.L. grafted on sour orange.

ANTIFUNGAL ACTIVITY OF LEAF EXTRACTS OF LAUREL,SWEET ORANGE, AND OLIVE, OBTAINED USING THE SU-PERCRITICAL CARBON DIOXIDE TECHNIQUE. U. DeCorato1, M. Trupo1, G. P. Leone1, G. Di Sanzo1, G. Zingarelli1and M. Adami2. ENEA, Dipartimento di Biotecnologie, Agro-industria e Protezione della Salute. 1Centro Ricerche Trisaia, StradaStatale 106 Jonica Km 419,500, 75026 Rotondella (MT), Italy.2Centro Ricerche Casaccia, Via Anguillarese 301, 00060 S. Maria diGaleria (Roma), Italy. E-mail: [email protected]

Several plants synthesize substances (phenols, sesquiterpenesand glucosides) which possess antifungal properties and may beof interest for use in crop protection. The purpose of this workwas to obtain leaf extracts with antifungal properties by an inno-vative process that utilise a supercritical CO2 technique. A pilotplant at ENEA was utilized for antifungal substance extractionfrom dried leaves of three Mediterranean plant species: olive(Olea europaea L.), sweet orange (Citrus sinensis Osbeck) andlaurel (Laurus nobilis L.) at conditions of 110 bar and 40°C. Anti-fungal activity tests were conducted in vitro on seven species ofplant pathogenic fungi: Alternaria alternata (Fr.) Keissler,Botryosphaeria dothidea (Moug. ex Fr.) Ces et De Not., Botrytiscinerea Pers., Fusarium culmorum (W.G. Sm.) Sacc., Penicilliumdigitatum (Pers.) Sacc., Rhizoctonia solani J. G. Kühn and Sclero-tinia sclerotiorum (Lib.) de Bary grown in Petri plates on potatodextrose agar (PDA). Each extract was tested at three differentconcentrations: 50, 125 and 250 µg ml-1 of PDA. The percentageof mycelial growth inhibition (MGI) was calculated as follows:%MGI = [(DMA – DE) / DMA] × 100; where DE = mycelialgrowth diameter in treatment sets, DMA = in control sets. The in-dex values were statistically analysed using Duncan’s test (Proba-bility = 0,01). The highest antifungal activity was shown by L. no-bilis extracs against B. cinerea. In particular, MGI was 85% when

the laurel extract was given to B. cinerea cultures at a concentra-tion of 250 µg ml-1.

BIOLOGICAL AND INTEGRATED CONTROL OF WHEATPOWDERY MILDEW. F. De Curtis, A.M. Spina, D. Piedimonte,G. Lima and V. De Cicco. Dipartimento di Scienze Animali, Vege-tali e dell’Ambiente, Università degli Studi del Molise, Via F. DeSanctis, 86100 Campobasso, Italy. E-mail: [email protected]

Powdery mildew of wheat, caused by Blumeria (= Erysiphe)graminis f. sp. tritici (anamorph: Oidium monilioides), is recog-nized as one of the main wheat diseases. Present control measuresagainst this pathogen are based on the use of fungicides at the pre-flowering stage. In order to find new ecocompatible control meth-ods against wheat powdery mildew, the yeasts Rhodotorula glutinis(isolate LS11) and Cryptococcus laurentii (isolate LS28) and theyeast-like fungus Aureobasidium pullulans (isolate LS30), previ-ously selected and tested for their wide range of activity againstdifferent fungal pathogens, were evaluated. In a two-year experi-ment carried out in wheat fields of the Molise region, the biocon-trol agents (BCAs) were applied alone or in combination with alow dosage of common fungicides or with natural adjuvants.Treatments were applied by spraying them twice at (i) flag leafstage and (ii) pre-flowering stage. Percentage of infected leaves,disease severity and the population level of BCAs on the leaveswere periodically assessed and the data were subjected to varianceanalysis. Results showed that the highest protection from powderymildew was given by BCAs applied in combination with some ad-juvants (i.e. calcium citrate, calcium chloride, calcium propionate,soybean oil and humic acid) as well as with a low dosage of fungi-cides. Moreover, highest levels of the antagonist population werefound on leaves treated with BCAs plus mineral salts.

MOLECULAR CHARACTERIZATION OF BOTRYOTINIAFUCKELIANA MUTANTS RESISTANT TO DICARBOX-IMIDES AND TO THE NEW CARBOXAMIDE BOSCALID.R.M. De Miccolis Angelini, C. Rotolo, W. Habib, S. Pollastroand F. Faretra. Dipartimento di Protezione delle Piante e Micro-biologia Applicata, Università degli Studi, Via Amendola, 165/A,70126 Bari, Italy. E-mail: [email protected]

The molecular bases of resistance to dicarboximide fungicidesand to the new chemical boscalid were investigated in Botryotiniafuckeliana (de Bary) Whetz. (Botrytis cinerea Pers.), the agent ofgrey mould on numerous crops. PCR-amplified fragments of thegenes encoding the target proteins, i.e. a two-component histi-dine kinase and succinate dehydrogenase, respectively, were se-quenced and compared in sensitive and resistant strains. Differ-ent point mutations were found in the histidine kinase gene fromrepresentative field and laboratory mutants with different level ofresistance to dicarboximides. In particular: (i) the substitutions atcodon 365 of isoleucine with serine (I365S) or asparagine (I365B)were detected in low-resistant mutants; (ii) the two substitutionsof glutamine with proline at position 369 (Z369P) and asparaginewith serine at position 373 (B373S) were associated with moder-ate resistance; (iii) the substitutions of glycine with asparagine atposition 357 (G357B) or glycine with serine at position 446(G446S) were present in highly resistant mutants displaying dif-ferent sensitivity to high osmotic pressure (a pleiotropic effect).Laboratory mutants resistant to boscalid showed single amino-acid substitutions in highly conserved cysteine-rich clusters of theiron-sulfur protein of the succinate dehydrogenase, whereas thesequences of the flavoprotein and the two transmembrane sub-



units of the enzyme did not differ in parental sensitive strains andderived mutants. The mutation from histidine to tyrosine atcodon 272 (H272Y), already known for inducing resistance tocarboxin in other fungi, was detected in low-resistant mutants.Proline to leucine or to phenylalanine replacements at position225 (P225L or P225F) were found in high-resistant mutants.

A RHABDOVIRUS ASSOCIATED WITH HIBISCUS VEINCLEARING DISEASE IN SOUTHERN ITALY. A. De Stradis1, G.Parrella2, C. Vovlas3, A. Ragozzino4. 1Istituto di Virologia Vegetaledel CNR, Via Amendola 165/A, 70126 Bari, Italy. 2Istituto per laProtezione delle Piante del CNR, Via Università 133, 80055 Portici(NA), Italy. 3Dipartimento di Protezione delle Piante e MicrobiologiaApplicata, Università degli Sudi, Via Amendola 165/A, 70126 Bari,Italy. 4Dipartimento di Arboricoltura, Botanica e Patologia Vegetale,Università degli Studi di Napoli “Federico II”, Via Università 100,80055 Portici (NA), Italy. E-mail: [email protected]

Several commercial Hibiscus rosa-sinensis cultivars showingvein clearing symptoms were observed since 2005 in Campaniaand Calabria (Southern Italy) from which a virus was mechanical-ly transmitted to herbaceous hosts. Nicotiana occidentalis and N.clevelandii reacted with yellow local lesions followed by systemicvein clearing, mottling, mosaic and stunting, whereas N. ben-thamiana and N. glutinosa developed only systemic symptomsand Gomphrena globosa reacted locally with reddish local lesions.No symptoms were observed in N. rustica, Chenopodium quinoa,C. amaranticolor and Citrullus vulgaris. Systemic symptoms inNicotiana spp. appeared often about one month after inoculation.Electron microscope observation of leaf dips and ultrathin sec-tions of chlorotic perninerval leaf areas revealed the consistentpresence of rhabdovirus-like particles. Virions measured 230x70nm and in thin sectioned cells were localized between the innerand outer membrane of the nuclear envelope. A similar disease ofH. rosa-sinensis has been previously reported from Morocco,Tenerife and Rhodes. The associated virus was identified as anisolate of Eggplant mottled dwarf virus. This appears to be thefirst record of the natural occurrence of a nucleorhabdovirus inItaly in the same host. Since Hibiscus spp. are vegetatively propa-gated, the introduction of infected materials is strongly suspectedas the cause of the widespread presence of Hibiscus vein clearingin southern Italy.

EARLY DETECTION OF AFLATOXIGENIC FUNGI ONMAIZE SEEDS. A. Del Fiore1, S. Serranti4, A. Ricelli3, M. Re-verberi2, A.A. Fabbri2, A. Bonifazi4 and C. Fanelli2. 1Dipartimen-to Biotecnologie, Agroindustria e Protezione della Salute, ENEA,Centro di Ricerche della Casaccia, Via Anguillarese 301, 00123Santa Maria di Galeria (Roma), Italy. 2Dipartimento di BiologiaVegetale, Università “La Sapienza”, Largo Cristina di Svezia 24,00165 Roma, Italy. 3Istituto di Scienze delle Produzioni Alimentaridel CNR, Via Amendola 122/O, 70126 Bari, Italy. 4Dipartimentodi Ingegneria Chimica dei Materiali, delle Materie Prime e Metal-lurgia, Università “La Sapienza”, Via Eudossiana 18, 00184 Roma,Italy. E-mail: [email protected]

Fungi can grow on many food commodities. Some fungalspecies that belong to the genus Aspergillus are able to synthesiseand release in the environment carcinogenic toxins, such as afla-toxins. A. flavus and A. parasiticus, produce, under suitable con-ditions, aflatoxins, secondary metabolites which are toxic for hu-man and animals. Aflatoxigenic fungi are a real issue, especiallyfor the cereal industry. Several studies have tried non-destructive,

spectral methods to detect fungal contamination and toxins oncereals. Many methods have been utilized to measure fungal con-tamination and the presence of these toxins. The aim of this workis the early detection of aflatoxigenic fungi in cereals, such maize,the discrimination between healthy and diseased cereals and thedetermination of the extent of damage caused by the use of hy-perspectral imaging and DNA-based methods. A hyperspectralimaging system, ImSpectorTM, V10 and two aflatoxigenicspecies, A. parasiticus, and A. flavus were used in this work. Bothfungi were inoculated on maize and were imaged from 24 h to 7days of growth. Changes in reflectance of maize were observedduring fungal growth. This approach could be a rapid methodfor detecting the aflatoxigenic fungi on cereals. New methods de-veloped in recent years include DNA-based analytical methods(PCR) for detection of fungi. We present a molecular method,based on PCR amplification of the omt gene, which encodes theenzyme necessary for the last step of aflatoxin biosynthesis.Specificity was assayed with DNA extracted from 7 different fun-gal species. Amplification was obtained only with DNA fromaflatoxigenic A. flavus and A. parasiticus.

EPIDEMIOLOGICAL ASPECTS OF WOOD DECAY OF KI-WIFRUIT (ACTINIDIA DELICIOSA). S. Di Marco and F. Osti.Istituto di Biometeorologia del CNR, Via P. Gobetti 101, 40129Bologna, Italy. E-mail: [email protected]

A new form of wood decay caused by several fungi has recent-ly been observed on kiwifruit (Actinidia deliciosa var. deliciosa).Trunk and shoots of diseased vines show decayed areas surround-ed or preceded by wood discoloration. Symptoms appear on thefoliage of the current season as chlorotic areas that soon becomenecrotic; leaves tend to curl, wilt and drop prematurely. In somecases, fruits do not reach full maturity. Repeated surveys wereconducted in a typical Emilia-Romagna (northen Italy) kiwifruit-growing area in order to investigate the incidence of the diseaseand the relation between foliar symptom expression and environ-mental factors. The disease proved to be widespread throughoutthe surveyed area. Foliar symptoms did not appear regularlyevery season, as they failed to appear in a certain years or forsome years in succession, even though vines were still infected.The number of infected vines increased since the first year of thesurvey. The time of appearance and the development of the dis-ease during the growing season correlated with plant physiologyand climatic factors. In particular, the annual incidence of thedisease was affected by the June-August temperatures in terms ofsymptomatic shoots and vines. A similarity between esca ofgrapevine and wood decay of kiwifruit was hypothesized.

INFLUENCE OF POLYAMINE TREATMENTS ON CUCUM-BER MOSAIC VIRUS INFECTION IN TOMATO. E. Di Nicola-Negri1, P. Tavladoraki2, L. Salandri1 and V. Ilardi1. 1CRA, Istitu-to Sperimentale per la Patologia Vegetale, Via C.G. Bertero 22,00156 Rome, Italy. 2Dipartimento di Biologia, Università deli Studi“Roma Tre”, Viale G. Marconi 446, 00146 Rome, Italy. E-mail:[email protected]

Cucumber mosaic virus (CMV) is one of the most detrimentalpathogens of tomato causing important yield losses worldwide. Inthe last twenty years different approaches, besides the use oftransgenic plants, have been explored to control CMV infectionbut none of them proved to succeed in controlling this viralpathogen. Polyamines are low-molecular weight organic com-pounds involved in plant defence responses elicited by biotic and



abiotic stresses. Moreover, H2O2 production through polyamineoxidation is correlated with oxidative burst, cell death, as well aslignification and suberization processes occurring during defenceresponses. In order to analyse the influence of polyamines onCMV infection four tomato cultivars (Corbarino, Galatino, Vesu-viano and UC82B) and one hybrid (Tomito) were sprayed withputrescine and spermidine and with the polyamine analogueguazatine and viral infection was monitored by visual inspectionof CMV-inoculated plants and ELISA. Results of the impact ofpolyamines treatments on CMV infection are reported and dis-cussed.

SUSCEPTIBILITY OF DIFFERENT FABABEAN GENOTYPESTO UROMYCES FABAE IN THE OPEN FIELD. B. D’Onofrioand M. Zaccardelli. CRA, Istituto Sperimentale per le Colture Industriali, Strada Statale 18 n. 204, 84091 Battipaglia (SA), Italy.E-mail: [email protected]

Uromyces fabae (Pers.) de Bary is the causal agent of blight offababean and other wild and cultivated leguminous plants. Typi-cal symptoms consist of pustules on the leaves surrounded by achlorotic halo. The use of tolerant varieties is the best strategy tocontrol the pathogen. In an experimental field located in the SeleValley in Southern Italy, heavy attacks of U. fabae developed atthe end of winter 2007. Using a severity index from one to five (1= no symptoms; 2 = slight symptoms on the leaves; 3 = heavysymptoms on the leaves; 4 = symptoms on the leaves and partiallyon the stem; 5 = heavy symptoms on the leaves and stem), diseaseseverity was assessed in April. Among the twelve different geno-types of fababean under trial, the strongest disease symptomswere observed on “Betty” (mean index 3.6), “Espresso” (meanindex 3.45), “Lady” (mean index 3.0) and “Vitabon” (mean in-dex 3.0). The lowest disease severity was observed on “Pro-thabon 101” (mean index 1.1), “Prothabat 69” (mean index 1.6),“Scuro di Torre Lama” (mean index 1.6) and “Merkur (mean in-dex 1.9). The genotypes “Chiaro di Torre Lama”, “Sicania”, “Ire-na” and “Castel”, showed a mean severity index of 2.5, 2.75, 2.75and 2.9, respectively.

DEVELOPMENT AND EVALUATION OF A CULTURE-INDE-PENDENT SEMI-NESTED PCR ASSAY FOR DETECTION OFBOTRYOSPHAERIA spp. DNA IN GRAPEVINE TISSUES. S.Essakhi, G. Marchi, L. Mugnai, F. Peduto, A. Spagnolo and G.Surico. Dipartimento di Biotecnologie Agrarie, Università degli Studi, Piazzale delle Cascine 28, 50144 Firenze, Italy. E-mail: [email protected]

In recent years fungi from the genus Botryosphaeria Ces. & DeNot. have become increasingly important worldwide among thefungi that cause decline and other diseases in grapevine trunks.Diagnosis of the diseases caused by these fungi is complicated be-cause most of the symptoms (cankers, dieback, decline, woodnecrosis, graft-union failure, fruit rot, ect.) induced by one or an-other of the 11 Botryosphaeria species so far reported as poten-tially phytopathogenic to grapevine, are aspecific, and becausethe identification to the species level is difficult, especially whenit relies only on the morphology of the isolates. Currently, therehave been only two reports in Italy of Botryosphaeria species at-tacking grapevine, both attributed to B. obtusa, a ubiquitousspecies with a quite variable virulence. In order to better under-stand the presence and spread of the various species ofBotryosphaeria in vine propagation material and in Italian vine-yards, a culture-independent semi-nested PCR assay was devel-

oped that targeted the internal transcribed spacer region (ITS1-5.8S-ITS2) of the nuclear ribosomal DNA of Botryosphaeria. Thespecific identity of the amplified DNA was determined by se-quencing both strands and by pairwise comparisons with the ho-mologous sequences available in GenBank database. Resultsshowed that the most common Botryosphaeria species were by farB. dothidea and B. obtusa both of which are not considered as themost virulent of the Botryosphaeria species that attack grapevine.

CONTROL OF OCHRATOXIGENIC ASPERGILLI ANDOCHRATOXIN A BIOSYNTHESIS IN GRAPES BY ANTAGO-NISTIC YEASTS AND AN ANTIFUNGAL NATURAL COM-POUND. M. Favilla1, M. Pascale1, A. Ricelli1, A. Evidente2, C.Amalfitano2 and C. Altomare1. 1Istituto di Scienze delle ProduzioniAlimentari del CNR, Via Amendola 122/O, 70126 Bari, Italy. 2Di-partimento di Scienze del Suolo, della Pianta e dell’Ambiente, Uni-versità degli Studi di Napoli “Federico II”, Via Università 100,80055 Portici (NA), Italy. E-mail: [email protected]

Ochratoxin A (OTA) is a nephrotoxic and carcinogenic myco-toxin. Lately, there has been a growing interest in the occurrenceof OTA in grapes and derivatives, including wines, mainly causedby fungi of the Aspergillus section Nigri. Management of the sani-tary state of grapes is a critical point in a strategy aimed at pre-venting OTA occurrence in wine. We examined the ability offusapyrone (FP), an antifungal metabolite of Fusarium semitec-tum, and of antagonistic yeasts to inhibit ochratoxigenic As-pergillus species and prevent OTA production. Artificiallywounded grapes (cv. Negroamaro) were inoculated with A. car-bonarius and treated with: (i) a solution of FP at 100 mg/l, (ii)biocontrol yeasts, (iii) a combination of FP at 50 mg/l and yeasts.Grapes were incubated in moist chambers at 25°C in the dark for10 days. Significant inhibition of fungal growth was observed inthe 100 mg/l FP-treated grapes. Ergosterol content was 72% lessthan control and conidiation was almost completely inhibited.The OTA content was reduced by 99%. At 50 mg/l, FP reducedboth the viable mould count (by 99%) and OTA production (by79%). The efficacy of antagonistic yeasts was dose-dependentand the best performance was observed at the highest cell con-centration tested (108 cells/ml). Neither additive nor synergisticeffect was observed with biocontrol yeasts plus 50 mg/l of FP. Re-sults show that both FP and yeasts were able to control A. car-bonarius and OTA contamination and suggest that the use of FPin rotation with antagonistic yeasts is a feasible strategy for man-agement of OTA occurrence in grapes.

PHYLOGENETIC CHARACTERIZATION OF PSEUDOMONASSYRINGAE pv. TABACI AND THE ROLE PLAYED BY THE EFFECTOR PROTEIN HOPQ1-1 IN DETERMINING ITS VIRULENCE AND HOST SPECIFICITY. P. Ferrante1, R.Buonaurio1 and B.A. Vinatzer2. 1Dipartimento di Scienze Agrarie eAmbientali, Sezione di Arboricoltura e Protezione delle Piante, Uni-versità degli Studi, Via Borgo XX Giugno 74, 06121 Perugia, Italy.2Department of Plant Pathology, Physiology and Weed Science, 551Latham Hall (0390), Virginia Tech, Blacksburg, VA 24061, USA. E-mail: [email protected]

Pseudomonas syringae pv. tabaci strains, responsible for wild-fire and blackfire diseases of tobacco, were phylogenetically char-acterized via multilocus sequence typing (MLST). MLST analysisbased on the sequence of four gene fragments of eight P. syringaepv. tabaci strains, P. savastanoi pv. phaseolicola 1448A and elevenP. syringae strains already characterized via MLST by Hwang et



al. (Appl. Environ. Microbiol. 71: 5182-5191, 2005) revealed thatour P. syringae pv. tabaci strains are all closely related to the com-pletely sequenced P. savastanoi pv. phaseolicola 1448A strain.Moreover, we confirmed our previous rep-PCR results that all an-alyzed Pseudomonas syringae pv. tabaci strains are representativesof the same clonal group. The presence of 21 P. savastanoi pv.phaseolicola 1448A effector genes was determined in thePseudomonas syringae pv. tabaci strains by PCR. The effectorgenes hopR1, hopAE1, hopAH2, hopAN1, hopAS1, hopAJ2,hopD1, hopI1, hopX1 and hrpK1 were found. P. syringae pv. tabacitransformants were obtained introducing individually six effectorgenes of P. savastanoi pv. phaseolicola 1448A which are absent inthe P. syringae pv. tabaci genome. Virulence was tested in beanand Nicotiana benthamiana plants. We observed that the growthin planta of the transformant bearing the hopQ1-1 gene was sig-nificantly increased in bean and reduced in N. benthamiana. Vir-ulence of the other five transformants was not changed. From ourresults, we can deduce that hopQ1-1 is an important virulencedeterminant of P. savastanoi pv. phaseolicola and that it triggers adefence response in N. benthamiana.

SAFFRON (CROCUS SATIVUS L.) DISEASES IN ITALY. M.Fiori1, G. Falchi1, M. Quaglia2 and C. Cappelli2. 1Dipartimentodi Protezione delle Piante, Università degli Studi Via E. De Nicola9, 07100 Sassari, Italy. 2Dipartimento di Scienze Agrarie e Ambien-tali, Università degli Studi, Borgo XX Giugno 74, 06121 Perugia,Italy. E-mail: [email protected]

Surveys carried out in different Italian saffron-growing areasshowed the presence of some fungal and bacterial diseases. Fusar-ium oxysporum f. sp. gladioli, a fungus transmitted through in-fected corms, was the major responsible of severe yield losses, es-pecially in central Italy and, recently, also in Sardinia (MedioCampidano). Primary symptoms occurred during flowering.They included basal stem rot, yellowing and wilting of the shootsand corm rot. The rapid spread of the disease is caused by move-ment of contaminated and/or infected corms. The Italian fungusisolates from saffron did not differ by those obtained from gladi-olus or saffron grown in Spain as shown by VCs groups studies.Macrophomina phaseolina was found in Sardinia. The fungus wastransmitted by infected corms and caused wilting of plants andcharcoal rot of corms. Penicillium spp. and Stromatinia gladioliwere also found in/on the corms at the time of transplanting. Re-cent investigations carried out in Sardinia showed that Burkolde-ria sp. and Pseudomonas spp. are the causal agents of a diseasecharacterized by rotting of the leaves, flowers and corms. Smoothand winkled colonies were isolated from plants and corms. Bacte-rial isolates were characterized by pathogenicity, phenotypic andPCR analysis. Most of the isolates were identified as Burkholderiagladioli and some as fluorescent pseudomonads. FLP analysis areunder way to characterize the pathovar of the B. gladioli isolates.Other fungi that were recorded many years ago, such as Rhizocto-nia spp. and Phoma crocophila, were not found.

BIOFUMIGATION: INTERACTION BETWEEN TRICHO-DERMA AND THE GLUCOSINOLATE-MYROSINASE SYS-TEM. S. Galletti, E. Sala, P.L. Burzi, O. Leoni and C. Cerato.CRA, Istituto Sperimentale per le Colture Industriali, Via di Corti-cella 133, 40129 Bologna, Italy. E-mail: [email protected]

Biofumigation is a biocontrol method based on the exploita-tion of the glucosinolate-myrosinase system contained in all Brassi-caceae tissues. Green manuring represents the technique utilised

to activate the system but also seed meal incorporation into soil isan attractive alternative. In the presence of water, the enzyme my-rosinase degrades glucosinolates into toxic compounds, mainlyisothiocyanates, lowering soil-borne pathogen inoculum. The ef-fects of the biocidal compounds on the beneficial soil microfloraneed to be carefully evaluated. Thus a screening was carried out invitro among 40 Trichoderma isolates for tolerance to allyl-isothio-cyanate (AITC) released by myrosinase degradation of sinigrinfrom moistened seed meal of Brassica carinata. Most isolates suf-fered a fungistatic effect, while a few were killed, like two patho-genic isolates of Pythium ultimum and Rhizoctonia solani. In addi-tion, one Trichoderma isolate tolerated very well AITC, showing ashort lag phase, due to its ability to reduce AITC concentration inthe Petri dish atmosphere, as determined by GC analyses. Furtherinvestigation showed that this isolate was also able to grow in liq-uid and solid culture additioned with pure sinigrin. The presenceof AITC in the atmosphere of the cultures, revealed by GC analy-ses, and the progressive decrease in sinigrin content in the liquidsubstrate, determined by HPLC analyses, suggest that a fungalmyrosinase is involved. These findings account for a general goodtolerance of the beneficial fungus Trichoderma to biofumigationcarried out with sinigrin-containing matrix. However, the exis-tence in the soil of strains able to interact with toxic compoundsderived from sinigrin could affect biofumigation effectiveness.

CAPS ANALYSIS: A POSSIBLE EPIDEMIOLOGICAL AP-PROACH FOR THE STUDY OF ARMILLARIA GALLICA AT-TACKS TO DECLINING OAK TREES. A. Gatto, G. Sicoli, N.Luisi. Dipartimento di Biologia e Patologia Vegetale, Universitàdegli Studi, Via Amendola 165/A, 70126 Bari, Italy. E-mail:[email protected]

Oak decline is the result of one of the most severe forestpathogen outbreaks on a regional scale in Europe over the lastdecades. Among other fungal attacks observed in southern Italy,root infections have frequently been ascribed to populations oflocally widespread isolates of A. gallica, a weakly pathogenicspecies of the genus Armillaria, which is responsible for well-known and worldwide occurring root rot and wood decay. Bio-molecular techniques have been increasingly acknowledged aspowerful tools in the epidemiological approach toward diseasesin forest ecosystems. For this purpose, a study was carried out onthe intraspecific variability of a population of 96 A. gallica isolatessampled from the “Difesa Grande” oak stand located in Gravinadi Puglia (southern Italy), based on restriction fragment lengthpolymorphism analysis of the intergenic spacer 1 region of rD-NA, namely CAPS (cleaved amplified polymorphic sequence)analysis. Three different banding patterns were yielded by theisolates under study, one of which is commonly reported for thisspecies in the literature. The other two patterns were previouslydetected only once within a broad-scale Italian population thatwe had collected before. Therefore, it can be argued that, if theDNA region analysed is more variable than what has been report-ed till now for A. gallica, then the biodiversity within this speciesis more pronounced than previously thought. Thus, new perspec-tives seem to emerge for a better understanding of landscapepathology dynamics concerning oak decline.

FIRST REPORT OF ASCOCHYTA sp. ON GRASS PEA (LATH-YRUS SATIVUS L.) IN ITALY. A. Infantino1, N. Pucci1, G. Di Giambattista1, S. Vona1 and M. Zaccardelli2. 1CRA, Istituto Speri-mentale per la Patologia Vegetale, Via. C.G. Bertero 22, 00156Rome, Italy. 2CRA, Istituto Sperimentale per le Colture Industriali,



Strada Statale 18 n. 204, 84091 Battipaglia (SA), Italy. E-mail:[email protected]

Yellowish necrotic lesions containing black pycnidia were ob-served on stems and pods of several plants of grass pea (Lathyrussativus L.) grown in 2006 and 2007 in experimental fields in Bat-tipaglia (SA), and Corleto Perticara (PZ) (southern Italy). Isola-tions were attempted in the laboratory by placing symptomatictissues on potato dextrose agar amended with streptomycin sul-phate and ampicillin (100 ppm each). Fast growing colonies withabundant sporulating pycnidia producing 1-2 septate conidia(15.5 x 5.7µm) were obtained. Pathogenicity tests were done byspraying a conidial suspension of the isolate ISPaVe ER-1413 (3 ×105 spores ml-1) on 2-week-old seedlings of the following species:grass pea, lentil, fababean, pea, chickpea, alfalfa, lupin, Frenchbean, and vetch. Symptoms similar to those observed in the fieldappered after 15 days only on grass pea seedlings. Ascochyta sp.was reisolated from all infected plants. DNA of two isolates (IS-PaVe ER 1413 and ISPaVe ER 1415) was extracted and amplifiedwith ITS specific primers ITS5 and ITS 4. The obtained fragmentca 600 bp in size was directly sequenced on both strands. Homol-ogy search with BLAST in GenBank sequences revealed 99%identity with a comparable sequence of Ascochyta lentis (acces-sion no. AY131201). Nevertheless, the lack of disease symptomson any leguminous species tested other than L. sativus castsdoubts on the identification at the species level. Ascochyta blightcaused by Mycosphaerella pinodes is reported to cause damage toL. sativus worldwide. To our knowledge, this is the first report ofAscochyta sp. on L. sativus.

Research supported by the Ministry of Agricultural, Alimenta-ry and Forestry Politics with funds released by C.I.P.E. (Resolu-tion 17/2003).

FOMITIPORIA MEDITERRANEA ASSOCIATED WITHWOOD ROT OF CITRUS IN SICILY. A. Ippolito1, F. Nigro1, L.Schena2, S.O. Cacciola3, F. Raudino2 and G. Magnano di SanLio2. 1Dipartimento di Protezione delle Piante e Microbiologia Ap-plicata, Università degli Studi, Via Amendola 165/A, 70126 Bari,Italy. 2Dipartimento di Gestione dei Sistemi Agrari e Forestali,Università Mediterranea, Loalità Feo di Vito, 89060 Reggio Ca-labria, Italy. 3Dipartimento di Scienze Entomologiche, Fitopato-logiche, Microbiologiche e Zootecniche, Università degli Studi,Viale delle Scienze 2, 90128 Palermo, Italy. E-mail: gmagnano@ unirc.it

Heartwood rot is a chronic disease occurring endemically inmost citrus growing areas of the world. It results in decay anddeath of scaffold limbs and branches and affects old trees whereenvironmental conditions, such as close tree spacing or frost, areconducive to infection. Although this disease is not a limiting fac-tor to the citrus industry it can contribute to the deterioration ofthe groves. As infection extends downward in the trunk, topwork-ing of the trees may become problematic. Several basidiomyceteshave been reported to be associated with wood decay of citrustrees. Early studies attributed heartwood rot of citrus trees toFomes applanatus. However, the fungus described under thisname was probably Fomitiporia mediterranea, a recently describedspecies which is associated with wood decay of grapevines affect-ed by esca. Recently, F. mediterranea was found to be associatedwith wood decay of citrus trees in Greece. It had previously beenreported as F. punctata from Apulia (southern Italy). In a survey ofcitrus groves in Sicily, F. mediterranea was found to be associatedwith heartwood rot in many sites. The fungus was isolated frominfected wood and basidiocarps. It was identified by PCR-amplifi-

cation and sequencing of the ITS regions of rDNA. In old or-chards typical resupinate basidiocarps of F. mediterranea werefound on branches of a high proportion of trees. Interestingly, theincidence of wood rot caused by F. mediterranea was high in 20 to30-year-old orange orchards which had been replanted in siteswith a previuous disease history.

SERIOUS OUTBREAKS OF ROOT AND CROWN NECROSISOF STRAWBERRY IN SOUTHERN ITALY. E. Lahoz1, R. Caiaz-zo1, A. Carella1, A. Fanigliulo2,3, S. Comes2 and A. Crescenzi2.1CRA, Istituto Sperimentale per il Tabacco, Via Vitiello 108, 84018Scafati (SA), Italy. 2Dipartimento di Biologia, Difesa e Biotecno-logie Agro-Forestali, Università degli Studi della Basilicata, Via dell’Ateneo Lucano 10, 85100 Potenza, Italy. 3Bioagritest Srl,zona PIP lotto E2, 85010 Pignola (PZ), Italy. E-mail: [email protected]

During autumn-winter 2006/2007 a serious disease was ob-served in young strawberry plants cv. Ventana grown under plas-tic tunnels in Basilicata and Campania (southern Italy). Symp-toms, present on about 50-60% of the plants, consisted in poordevelopment. Roots were necrotic and diffusely corky. Necrosisand brown areas occurred at the base of the crown, whichshowed a red tinge when sectioned. Isolation on several growthmedia yielded colonies mainly of Fusarium sp. and Phoma sp.Based on morphological and molecular characterization the twofungi were identified as Fusarium tricinctum (Corda) Saccardoand Phoma glomerata (Corda) Wollenweber et Hochapfel. Therole of the two agents in the genesis of the disease is discussed. Inpreliminary pathogenicity tests, the two fungi, when inoculatedcontemporarily, gave symptoms similar to those observed in thefield.

OPTIMIZATION OF AN INDUSTRIAL FERMENTATIONPROCESS FOR THE PRODUCTION OF NOVEL TRICHO-DERMA-BASED FORMULATIONS. S. Lanzuise1, M. Ruocco2,S. Woo1, V. Aloj1, D. Turrà1, F. Vinale1, R. Marra1 and M.Lorito1. 1Dipartimento di Arboricoltura, Botanica e Patologia Ve-getale, Sezione di Patologia Vegetale, Università degli Studi diNapoli “Federico II”, Via Università 100, 80055 Portici (NA) Italy.2Istituto per la Protezione delle Piante del CNR, Via Università133, 80055 Portici (NA), Italy. E-mail: [email protected]

Several members of the genus Trichoderma are being pro-posed commercially as alternatives to chemical fungicides. How-ever, full-scale application of Trichoderma for the biological con-trol of plant pathogens has not been widely implemented also be-cause the technology for mass production of Trichoderma spp.spores, enzymes (cellulose, a-amylase, xylanase, chitinase, b-glu-canase) and extra cellular metabolites via submerged fermenta-tion still requires improvement for application at an industrialscale. The aim of present study is to optimize culture conditionsthat influence both enzyme and spore production by T.harzianum in large submerged cultures, thus obtaining a new for-mulation that contains enough of highly active propagules andenzymes. Maximum chitinase, glucanase and xylanase productionwas obtained when fermentation was carried out at 25°C for 72 husing 72 h old mycelium and lyophilised fruiting body of Agari-cus bisporus plus cereal fibre as the sole carbon source. Very fewspores were observed in cultures grown at 100 rpm even after120 h of fermentation (HF). In cultures grown at 200 rpm, exten-sive sporulation and mycelium fragmentation was observed after72 HF; after 96 HF, also fragmented mycelium began sporulationand at 120 HF a high number of spores were produced. The new



formulation obtained (spore plus enzymes) showed a high bio-control activity against many foliar and soil pathogens, and also agood biofertilizer effect.

EVALUATION OF COMPOSTS AND AMENDMENTS FORSUPPRESSIVE ACTIVITY AGAINST VERTICILLIUM DAHLI-AE ON NURSERY-GROWN OLIVE PLANTS. G. Lima1, F. DeCurtis1, D. Piedimonte1, D. Vitullo1, I. Pentimone2 and F. Nigro2.1Dipartimento di Scienze Animali, Vegetali e dell’Ambiente, Sezionedi Patologia Vegetale, Università degli Studi del Molise, Via DeSanctis, 86100 Campobasso, Italy. 2Dipartimento di Protezione dellePiante e Microbiologia Applicata, Università degli Studi, Via Amen-dola 165/A, 70126 Bari, Italy. E-mail: [email protected]

Verticillium wilt, caused by Verticillium dahliae Kleb., is oneof the most severe diseases of olive and other important cropsworldwide. In the last decades the disease has occurred with in-creasing frequency and severity in most olive-growing areas. Itscontrol has relied on chemical biocides but more eco-compatibleand safer control mesures are necessary. Preventive methods (i.e.pathogen-free soil and planting material, suppressive substratesand biocontrol agents) have been implemented in the nurseriessince they are considered key factors for an efficient disease con-trol. Recently, alternative substrates for plant growth containingnatural amendments and plant composted biomasses are beingstudied not only for agronomic properties, but also for their sup-pressiveness against soil-borne pathogens. To prevent V. dahliaeinfections our investigations were aimed at evaluating the sup-pressive activity of different composts and amendments, alone orenriched with biocontrol agents, against microsclerotia (MS) ofthe pathogen. The experimental products at 15% concentration(v/v) were mixed with a standard substrate and the mixtureswere artificially contaminated with 50 MS/g. Trials were conduct-ed under growth chamber and nursery conditions. In blind trialexperiments, the pathogen was periodically monitored in the soilby either semi-selective medium and real-time nested ScorpionPCR. Results showed that some composts and amendments re-duced significantly the density of V. dahliae MS in the rizosphereof young olive plants. Further studies are in progress to optimizethe suppressive activity of these alternative substrates in order toprotect olive plants from V. dahliae infection in the nursery.

ACTIVITY AGAINST FUSARIUM OXYSPORUM OF ANTAG-ONIST BACTERIA ISOLATED FROM SUPPRESSIVE SOILSOR COMPOSTS. 1G. Lima, 1D. Vitullo, 1F. De Curtis, 1D. Piedi-monte, 2L. Maiuro and 1V. De Cicco. 1Dipartimento di Scienze An-imali, Vegetali e dell’Ambiente, Sezione di Patologia Vegetale, Uni-versità degli Studi del Molise, Via De Sanctis, 86100, Campobasso,Italy. 2Dipartimento di Scienze e Tecnologie Agro-Alimentari, Am-bientali e Microbiologiche, Università degli Studi del Molise, Via DeSanctis, 86100 Campobasso, Italy. E-mail: [email protected]

The most common approach to biological control involves se-lection of antagonist microorganisms, elucidation of their modesof action, optimization of the antagonistic activity and develop-ment of biocontrol products. The rate of suppressiveness of com-posts and natural amendments against soil-borne pathogens(Fusarium oxysporum, Phytophthora spp., Pythium spp., Rhizocto-nia solani, Sclerotinia spp., Sclerotium rolfsii, Verticillium dahliae,and others) depends on several characteristics of these substratessuch as chemical components, composting conditions and mi-croorganic components. Among microorganisms populating dif-ferent composts and amendments, over 130 bacterial strains were

isolated and assayed in vitro for their antagonist activity against F.oxysporum f.sp. lycopersici. Some of the most effective antagonistswere studied for their in vitro and in vivo interaction with bothpathogen and roots of tomato plants. Results of these investiga-tions showed that 26 bacterial strains inhibited the radial growthof F. oxysporum on agarized medium; moreover, on liquid medi-um, bacterial culture filtrates reduced both germination and germtube-elongation of fungal spores. Scanning electron microscopyobservations of two antagonist bacteria showed that bacterial cellsadhere to F. oxysporum hyphae causing collapse of the fungal cellwall. This research gives useful information to optimize the activi-ty of biocontrol bacteria in order to develop new and high effec-tive bioformulates for use in eco-compatible agriculture.

EVALUATION OF NEW BIOCONTROL AGENTS FOR SUP-PRESSION OF ARTICHOKE CROWN ROT CAUSED BYSCLEROTIUM ROLFSII. B.T. Linaldeddu, L. Maddau, A. Fran-ceschini and F. Marras. Dipartimento di Protezione delle Piante,Sezione di Patologia Vegetale, Università degli Studi, Via E. DeNicola 9, 07100 Sassari, Italy. E-mail: [email protected]

Sclerotium rolfsii Sacc. is one of the most important soil-borneplant pathogens widespread in the tropic, subtropic and temper-ate regions on a wide range of economically important crops. InSardinia (Italy), it causes serious losses on monocultures of arti-choke. In recent years, several antagonistic micro-organisms havebeen used as an alternative to chemical products for controllingS. rolfsii attacks under field conditions, often with unsatisfactoryresults. In previous in vitro tests a strong antagonistic activity oftwo oak fungal endophytes, Bionectria solani (Reinke et Berthold)Schroers and Trichoderma sp. 1, and two soil-borne fungi, Tricho-derma viride Pers. and Trichoderma sp. 2, was observed against S.rolfsii. In the present work the capability of these fungi to pre-vent artichoke crown rot by S. rolfsii in greenhouse experimentswas tested. Furthermore, the production of secondary metabo-lites potentially involved in biocontrol mechanisms was evaluat-ed. Results indicate that all the antagonistic fungi significantly re-duce disease incidence; in particular, B. solani and Trichodermasp. 1 reduced plant mortality by up to 89%. The four fungi test-ed produced in vitro secondary metabolites, the chemical and bi-ological characterization of which is in progress.

PRELIMINARY RESULTS ON THE RESPONSE OF THE TRA-DITIONAL FRENCH BEAN CULTIVARS “FAGIOLI DI SAR-CONI” TO THE VARIETIES FUSCANS AND NON FUSCANSOF XANTHOMONAS AXANOPODIS pv. PHASEOLI. P. LoCantore, G. Figliuolo and N.S. Iacobellis. Dipartimento di Biolo-gia, Difesa e Biotecnologie Agro-Forestali, Università degli Studidella Basilicata, Via dell’Ateneo Lucano 10, 85100 Potenza, Italy.E-mail: [email protected]

The cultivation of “Fagioli di Sarconi”, a pool of high valuetraditional French bean varieties grown in Basilicata (southernItaly) for the production of dry seeds, is limited by commonblight, caused by the variety fuscans of Xanthomonas axonopodis.pv. phaseoli. Five of the above traditional varieties were artificiallyinoculated with two selected virulent strains of the varieties fus-cans and non fuscans of X. a. pv. phaseoli for evaluating their sus-ceptibility-resistance. Bacterial suspensions containing 108

u.f.c./ml were injected into the first trifoliate leaf (4 inoculationsper leaflet) of bean plants grown in pots in greenhouse. Fourteen,21 and 28 days post inoculation the diameter of the lesions,which increased in size during the assays, was recorded and the



data obtained were analysed statistically. Bean cultivars were sus-ceptible to both bacterial varieties although a different responsewas observed. In particular, cvs Tondino bianco, Verdolino andCannellino were more susceptible that Tabacchino and Ciuotowhen inoculated with the strain of variety fuscans, while cvsTondino bianco, Tabacchino and Verdolino were more suscepti-ble than Ciuoto and Cannellino when the strain of the bacterialvariety non fuscans was used. The different response of bean cul-tivars to artificial inoculation suggests that several plant factorsare involved in the X. a. pv. phaseoli/French bean interaction, andthat these are apparently different among the traditional cultivarsof the “Fagioli di Sarconi” pool.

Research partially supported by the Ministry of Agricultural,Alimentary and Forest Politics with funds released by C.I.P.E.(Resolution 17/2003).

CHARACTERIZATION OF STRAINS OF THE VARIETIESFUSCANS AND NON FUSCANS OF XANTHOMONAS AX-ONOPODIS pv. PHASEOLI. P. Lo Cantore and N.S. Iacobellis.Dipartimento di Biologia, Difesa e Biotecnologie Agro-Forestali,Università degli Studi della Basilicata, Via dell’Ateneo Lucano 10,85100 Potenza, Italy. E-mail: [email protected]

Sixty strains of the varieties fuscans and non fuscans of Xan-thomonas axonopodis pv. phaseoli, obtained form typical lesionsand seed washings in different geographic areas including Italy,were characterized for different phenotypical features. All strainsproduced a yellow pigment on GYCA whereas only strains of X.a. pv. phaseoli variety fuscans produced a brown pigment whengrown on KB and MT. All strains hydrolysed starch, esculin andcasein, grew at 35°C and on minimal medium containing glucoseand mannose but not in the presence of arabinose and, in addi-tion, induced hypersensitivity reactions and disease symptomswhen injected with a syringe into pepper (cv. Early Calwonder)and bean (cv. Gipsy) leaflets. Virulence, evaluated as size of thelesions, varied among strains of each bacterial variety and, con-trary to previous observation, also between strains of the two va-rieties. The nutritional profile of the strains in question, obtainedwith the Biolog® Identification System (MicroLogTM System Re-lease 4.2, Biolog Inc., Hayward, CA, USA), showed that the twobacterial varieties utilise in a different way some of the 95 differ-ent sources of carbon. A different behaviour between the two va-rieties was also observed when fatty acid and total protein pro-files of strains of both groups were analysed. These features con-firm and strengthen recent data on the possible different taxo-nomic position of the varieties fuscans and non fuscans of X. a. pv.phaseoli.

Research partially supported by the Ministry of Agricultural,Alimentary and Forest Politics with funds released by C.I.P.E.(Resolution 17/2003).

PRELIMINARY RESULTS ON THE ANTAGONISTIC ACTIVI-TY OF FLUORESCENT PSEUDOMONAS spp. TOWARDSOME PATHOGENIC FUNGI OF FORESTRY PLANTS. P. LoCantore, A. Viggiano and N.S. Iacobellis. Dipartimento di Biolo-gia, Difesa e Biotecnologie Agro-Forestali, Università degli Studidella Basilicata, Via dell’Ateneo Lucano 10, 85100 Potenza, Italy.E-mail: [email protected]

Strains of fluorescent Pseudomonas spp., pathogens of the cul-tivated mushrooms and isolated from the rhizosfere of forestry

plants, inhibited in vitro the growth of Phytophthora spp., Heter-obasidion annosum, Armillaria mellea and Cryphonectria parasiti-ca in antagonistic assays. The antagonistic activity is apparentlydue to the production of antimicrobial metabolites and to hy-drolytic enzymes (i.e. proteases, glucanases, cellulases and chiti-nases) produced in vitro by the majority of the antagonistic bacte-ria. Chestnut seeds, inoculated with some selected strains ofPseudomonas tolaasii, P. reactans, P. fluorescens biotype C andPseudomonas spp., which were highly active in inhibiting thegrowth of phytopatogenic fungi in plate antagonism assays, wereprotected from the pathogenic activity of a strain of P. cambivora.In fact, chestnut seeds bacterized with the above bacteria, theninoculated with a virulent strain of P. cambivora, germinated andshowed a growth similar to the control chestnut seeds untreatedor bacterized only with the same antagonistic bacteria. By con-trast, chestnut seeds inoculated only with P. cambivora did notgerminate, did rot and were heavy colonised by the pathogen.These preliminary results suggest that these antagonistic bacteriamay have a potential use for seed bacterization practices.

STANDARDIZATION OF A COMMON PROTOCOL FOROLIVE VIRUS DETECTION. G. Loconsole1, M. Saponari1,2 F.Faggioli3, G. Albanese4, H. Bouyahia5, T. Elbeaino6, M. Nuz-zaci7, V. Prota8, G. Romanazzi9 and V. Savino1. 1Dipartimento diProtezione delle Piante e Microbiologia Applicata, Università degliStudi and Istituto di Virologia Vegetale del CNR, Sezione di Bari,Via Amendola, 165/A, 70126 Bari, Italy. 2Centro di Ricerca e Sper-imentazione in Agricoltura “Basile Caramia”, Via Cisternino 281,70010 Locorotondo (BA), Italy. 3CRA, Istituto Sperimentale per laPatologia Vegetale, Via C.G. Bertero 22, 00156 Roma, Italy. 4Di-partimento di Gestione dei Sistemi Agrari e Forestali, UniversitàMediterranea, Località Feo di Vito, 89060 Reggio Calabria, Italy.5Dipartimento di Coltivazione e Difesa delle Specie Legnose “G.Scaramuzzi”, Sezione di Patologia Vegetale, Università degli Studi,Via del Borghetto 80, 56124 Pisa, Italy. 6Istituto AgronomicoMediterraneo, Via Ceglie, 9, 70010 Valenzano (BA), Italy. 7Diparti-mento di Biologia, Difesa e Biotecnologie Agroforestali, Universitàdegli Studi della Basilicata, Via dell’Ateneo Lucano 10, 85100Potenza, Italy. 8Dipartimento di Protezione delle Piante, Sezione di Patologia Vegetale, Università degli Studi, Via De Nicola 9,07100 Sassari, Italy. 9Dipartimento di Scienze Ambientali e delleProduzioni Vegetali, Università Politecnica delle Marche, Via Brec-ce Bianche 1, 60131 Ancona, Italy. E-mail: [email protected]

Sanitary selection and certification of olive require sensitivediagnostic methods and effective sanitation protocols. Althoughmuch attention has been paid in the last few years to the develop-ment of diagnostic tools for reliable virus identification, the needto define common and consentaneous diagnostic protocols sug-gested to carry out a ring test with the participation of nine Ital-ian laboratories. Different protocols (one-step RT-PCR, dot-blothybridization) and reagents (primers, riboprobes), used for thedetection of the most common olive viruses, were tested compar-atively in each laboratory, using the same batch of positive sam-ples and healthy controls. One-step RT-PCR proved much moresensitive than dot-blot hybridization for all viruses, using as tem-plate total nucleic acid extracted with a commercial kit (Qiagen,Valencia, CA, USA). A primer set for olive leaf yellowing-associ-ated virus (OLYaV) was designed for broad-spectrum detectionof different viral isolates. Furthermore, a one-step RT-PCR proto-col was successfully used for the first time for Tobacco necrosisvirus (TNV) detection in olive tissues. Results showed that all in-vestigated viruses were not uniformly distributed in the canopyand that at least two sub-samples must to be collected from each



plant. The standardized protocol agreed upon will be used toproduce “primary sources” (nuclear stocks) of 70 different Italianolive varieties, in the framework of the national project OLVIVA,which involves 25 national research institutes.

Supported by the Progetto interregionale qualificazione delvivaismo olivicolo – OLVIVA.

A HIGH COMPUTING BIOINFORMATIC APPROACHBASED ON GRID FOR DETECTING RECOMBINATIONIN WHOLE CITRUS TRISTEZA VIRUS GENOME. S. Lom-bardo1,2, S. Davino2, M. Iacono Manno3 and A. Muoio3. 1Con-sorzio Cometa, Via S. Sofia 64, 95123 Catania, Italy. 2Dipartimentodi Scienze e Tecnologie Fitosanitarie, Università degli Studi, Via S. Sofia 100, 95123 Catania, Italy. 3Istituto Nazionale di Fisica Nucleare, Sezione di Catania, Via S. Sofia 64, 95123 Catania, Italy.E-mail: [email protected]

The high computing performance of distributed workstationcluster, like GRID, is useful in bioinformatics because the numberof available sequences in GenBank continues to grow at an expo-nential rate, doubling every 10 months. Furthermore, bootstrap-ping, the way of testing the reliability of the dataset by resamplingrequires very long processing times on conventional systems. Inour approach we analised Citrus tristeza virus (CTV), the causalagent of a major virus disease of citrus. CTV has a single-stranded,positive sense genomic RNA of nearly 20 Kb. Recombination inCTV can occur through either reassortment or “copy-choice”replication. In copy-choice replication, the viral RNA dependentRNA polymerase switches from one RNA molecule to anotherduring replication, generating mosaic genomes. Conventional phy-logenetic tree estimation methods assume that all sites have thesame evolutionary history. This assumption drops if recombina-tion has occurred among any sequences. Recombination producesmosaic sequences that may cause errors in phylogenetic tree esti-mation. We have integrated the most innovative computing appli-cations in virology research and bioinformatics on a GRID infra-structure. In particular, we have implemented in a single work-flow, three tools for pairwise or multiple sequences alignment andphylogeny tree construction (ClustaW-MPI 1.83), phylogeneticnetworks generation (SplitsTree 4.6) and recombination detectionby phylogenetic methods (TOPALi). The data obtained with thisanalysis fit with previous works, based on nucleotide identityanalysis, with considerable time saving.

INFLUENCE OF NUTRIENTS ON IN VITRO GROWTH OFARMILLARIA MELLEA. C.M. Longa and I. Pertot. Centro Safe-Crop, Via Mach 1, 38010 San Michele all’Adige, (TN), Italy. E-mail: [email protected]

Armillaria mellea is a slow-growing fungus causing root rot inforest and cultivated plants. Its slow in vitro growth results inlong lasting and time consuming experiments. The aim of thiswork was to evaluate the effect of different nutrient sources on A.mellea growth in order to speed it up. The effect on A. melleagrowth was assessed by adding different nutrients to malt extractagar (MEA) in 90 mm Petri dishes. Nutrient sources were addedto MEA at a rate of 2 g/l (nitrogen sources) and 5 g/l (carbonsources). Carbon sources tested were glucose, sucrose, mannose,threalose, galactose and corn strep liquor (CSL). Nitrogensources were peptone and yeast nutrient base (YNB). The pH ofgrowth media and water activity were 5.1±0.1 and 0.998 ±0.001respectively. The untreated control was MEA without additionalnutrient. Four replicates (Petri dishes/nutrient) were inoculated

and incubated at 22°C. Effect of nutrients sources was evaluatedon rhizomorphs production after seven days, and on colony areaand mycelial dry weight after 15 days of incubation. Addition ofCSL and sucrose produced a significant higher mycelial dryweight and colony area (Fisher’s test, P≤0.05) if compared withthe untreated control. Initial rhizomorphs production was stimu-lated by the addition of CSL, galactose and peptone. Morpholog-ical characteristics and pigment production were not affected bythe nutrient sources. CSL, a by-product of the corn wet-millingindustry, resulted in the best nutrient source to improve the invitro growth of A. mellea.

SOIL MICROCOSM APPROACH TO EVALUATE ANTAGO-NISTIC EFFECT OF POTENTIAL BIOCONTROL AGENTSAGAINST ARMILLARIA MELLEA. C.M. Longa and I. Pertot.Centro SafeCrop, Via Mach 1, 38010 San Michele all’Adige (TN),Italy. E. mail: [email protected]

Armillaria mellea root rots are impossible to control with cur-rently available methods. Biological control, either alone or inte-grated with other approaches (fumigation, agronomical practices,etc.), may have better perspectives. Results in biocontrol efficacyobtained with in vitro dual culture are often not consistent withwhat found in nature; this is because the soil can influence sur-vival and activity of the antagonist. We present a new, relativelyfast and cheap approach to evaluate the antagonistic effect of mi-croorganisms against A. mellea using soil microcosms. Soil micro-cosms (three replicates) were prepared in polypropylene bottlesas follows: five plugs of A. mellea mycelium and rhizomorphs,protected by sterile lens tissue, were placed between two layers of100 g of sieved sterile soil inoculated with 106 conidia of the test-ing microorganisms (Trichoderma atroviride, T. virens or T. longi-brachiatum). Microcosms were maintained for seven days at roomtemperature. Pathogen plugs were collected, surface sterilised bydipping in NaOCl (0.4%) for 10 min and rinsed in sterile dis-tilled water for 30 min. Pathogen samples were transferred toPetri dishes containing malt extract agar (MEA) and incubatedfor 15 days at 22°C. Antagonistic effect was evaluated as percent-age of pathogen growth failure on MEA (survival reduction). Thethree Trichoderma species significantly reduced pathogen survival(Tukey’s test, P≤0.05) compared to the control. T. atroviride andT. longibrachiatum grew in the pathogen plug after surface sterili-zation confirming their mycoparasitic activity.

PRELIMINARY SURVEY OF RALSTONIA SOLANACEARUMSTRAINS ISOLATED FROM TOMATO IN ITALY. S. Loreti1,M. Fiori2, D. De Simone1, G. Falchi2, A. Gallelli1 and A. Schiaf-fino2. 1 CRA, Istituto Sperimentale per la Patologia Vegetale, ViaC.G. Bertero 22, 00156 Roma, Italy. 2 Dipartimento di Protezionedelle Piante, Università degli Studi, Via E. De Nicola 9, 07100 Sas-sari, Italy. E-mail: [email protected]

Tomato wilting caused by Ralstonia solanacearum (RS) totomato cultivars Arawak, Cuore di Bue and Ikram growing ingreenhouses in Southern Sardinia was observed in February andApril 2007. Tomato plants were grown in the soil and in soil-lessculture in five greenhouses. The percentage of affected plants wasup to 70%. Isolations from symptomatic plants and from waterused for irrigation onto SMSA and TZCA media gave fluid whitecolonies with a red centre. Pathogenicity tests were done by inoc-ulating six isolates each on 9 plants of tomato, eggplant and to-bacco. Only tomato and eggplant plants wilted within two weeksand died; no symptoms were observed in tobacco and in control



plants. Isolates obtained originally and from artificially inoculatedplants were characterized by biochemical and physiological tests,BIOLOGTM system and IFAS. FAME analysis, performed on twoisolates, confirmed the similarity with RS. PCR with primersOLY-1 and Y-2, specific for RS, gave the expected band of 288bp. Digestion of PCR products with AvaII restriction endonucle-ase gave the same pattern as the reference strain. Rep-PCR andSDS-PAGE of whole-cell proteins confirmed the similarity of ourisolates with RS reference strain. Furthermore, partial 16S rDNAgene sequences of several isolates were compared with known se-quences of RS and their similarity was 100%. Sequences were de-posited in GenBank (Accession numbers from AM690474 toAM690480). In conclusion, it was ascertained that the bacteriaisolated from tomato in Sardinia have the same characteristics ofrace 3 of R. solanacearum.

PATHOGENESIS OF BRENNERIA NIGRIFLUENS TO WAL-NUT. S. Loreti1, S. Vitale1, A. Gallelli1, P. Piccirillo2 and A.Belisario1. 1Istituto Sperimentale per la Patologia Vegetale, ViaC.G. Bertero, 22, 00156 Roma, Italy. 2Istituto Sperimentale per laFrutticoltura, Via Torrino 3, 81100 Caserta, Italy.

Bark canker of English walnut caused by Brenneria nigrifluens,was reported for the first time in USA in 1957. Symptoms consist-ed in shallow, irregular brown necrotic areas in the bark of thetrunk and scaffold branches. Initially, small circular spots are visi-ble in the cortical tissue, and by the enlargement and coalescenceof several spots extensive cankers are formed. Watery exudatesooze through cracks on the bark. In Italy, occurrence of the dis-ease has been reported in 1998 in the north of Italy, and in a timeperiod of four years it was observed also in southern-central Italy.Several varieties are known to be susceptible to the disease. A sur-vey in a tree collection of J. regia varieties (C.R.A.-ISF of Caserta),in which the disease was widespread, showed that the cvs. Sorren-to, Bleggiana, Tehama, Corne, Gustine, Xerta 122, Amigo weresusceptible. To assess the disease development on susceptible andresistant Juglans species, a pathogenicity test was performed on 4-year-potted J. regia seedlings and 11-year-old J. regia, J. hindsii, J.sieboldiana trees. Necrosis progressed equally upward and down-ward the inoculation point. On J. sieboldiana no symptoms wereinduced on inoculated branches, confirming its resistance. Allcontrols were symptomless. On young plants, inoculations devel-oped sunken brownish areas. Lesions were more extended inwidth on young plants than on mature trees. Bleeding was neverproduced. Re-isolations of B. nigrifluens were positive at the lesionmargins for J. hindsii and J. regia and at the inoculation point for J.sieboldiana.

GENETIC VARIABILITY OF HETEROBASIDION ABIET-INUM ISOLATES COLLECTED FROM ABIES ALBA AND A.PINSAPO IN THE MEDITERRANEAN REGION. N. Luchi1,M.E. Sánchez2 and P. Capretti1. 1Dipartimento BiotecnologieAgrarie, Sezione di Patologia Vegetale, Università degli Studi. Piaz-zale delle Cascine 28, 50144 Firenze, Italy. 2Departamento deAgronomìa. ETSIAM, Universidad de Cordoba, Apdo 3048, 14080Cordoba, Spain. E-mail: [email protected]

Heterobasidion abietinum is a fungal pathogen that causesroot rot on Abies spp. in central and southern Europe. Generallythe highest incidence of the disease occurs in areas not optimalfor Abies and it may vary according to elevation, rainfall pattern,mean temperature and type of soil. Disease is severe along thesouthern Italian Apennines (Puddu et al., 2003. For. Ecol. Manag.

180: 37-44) and in Spain in some localities of Andalucia, whereroot damage can be extensive so as to lead to death of the trees ofAbies pinsapo in Sierra de las Nieves Natural Park (Sánchez, For-est Pathol., in press). The aim of the work was to investigate thegenetic variation of H. abietinum isolates collected from differentabies specie (A. alba and A. pinsapo) in three different localitiesof the Mediterranean region: Apennines, Pyrenees and Andalu-cia, in the far south of the Spanish peninsula. Samples of H. abiet-inum were analyzed on the basis of profiles obtained with directamplification of minisatellite M13 used as a primer. In a N-J den-drogram, H. abietinum isolates separated significantly into clus-ters, according to their geographical origin.

MOLECULAR CHARACTERIZATION OF FUSARIUM OXYS-PORUM f.sp. MELONIS L. Luongo1, M. Maccaroni1, A. Ferrari-ni2, S. Vitale1, A. Polverari3, M. Delledonne2 and A. Belisario1.1CRA, Istituto Sperimentale per la Patologia Vegetale, Via C.G.Bertero, 22, 00156 Roma, Italy. 2Dipartimento Scientifico e Tecno-logico, Strada Le Grazie 15, 37134 Verona, Italy. 3Dipartimento diScienze, Tecnologie e Mercati della Vite e del Vino, Villa Ottolini-Lebrecht, 37029 San Floriano di Valpolicella (VR), Italy. E-mail:[email protected]

Fusarium oxysporum f. sp. melonis is the causal agent of a de-structive vascular wilt disease of muskmelon (Cucumis melo)worldwide. The fungus penetrates directly the roots and colo-nizes the vascular system. Symptoms of the disease and the extentof colonization vary according to the host plant, fungal race(pathotype), and infection conditions. A collection of 39 isolatesof Fusarium oxysporum f. sp. melonis representative of all fourraces (0, 1, 2, and 1,2) was analyzed by several molecular tech-niques in the attempt to characterize the formae specialis and theraces. The principal target was to discriminate race 1,2, the mostvirulent and widespread race in Europe and Italy. Microsatellites(SSR and ISSR), and calmodulin partial sequence analysis wereunable to discriminate. In turn, minisatellites (M13 and T3B),translation elongation factor partial sequence analysis, andRAPDs allowed to clearly differentiate race 2 isolates from allother races, confirming its polyphyletic origin. With few excep-tions, race 1,2 isolates clustered together in RAPD analysis using23 primers out of 89 tested. A unique band was identified only inrace 1,2 isolates. The corresponding sequence will be used forspecific primer design.

EFFECT OF EXOTHERMIC REACTIONS IN STEAMINGTREATMENTS: TRIALS ON SCLEROTIA SURVIVAL USINGAN AD HOC CONSTRUCTED APPARATUS. A. Luvisi and E.Triolo. Dipartimento Coltivazione e Difesa delle Specie Legnose“G. Scaramuzzi”, Sezione di Patologia Vegetale, Università degliStudi, Via del Borghetto 80, 56124 Pisa, Italy. E-mail: [email protected]

Control of soil-borne pathogens using steam combined withexothermic reaction chemicals (Bioflash system) has been widelyinvestigated since 1999, obtaining interesting results in terms ofdisease reduction in open field condition against Sclerotinia mi-nor and Sclerotinia sclerotiorum. For securing information on themechanisms of action of the treatment a specially constructed ap-paratus was built for laboratory analysis on sclerotia. The centralbody of the apparatus contains a box for accomodating samplesand four pipes for dispensing air-steam mixture, and is filled withsoil during testing. The box, containing three sample holders inwhich sclerotia are mixed with soil, is equipped with sensors for



temperature monitoring. Pipes are connected with an externaltube which is in turn connected with a steam generator (0-60 gmin-1), while an additional pipe allows air to be pumped into thesystem. The apparatus was devised for simulating the thermal ef-fects of a mobile steam generator, at mild, medium or high condi-tions, with Tmax of 60, 70 and 100°C, respectively. These tem-peratures were maintained for 5 min, then followed by a progres-sive reduction. Treatments were repeated adding calcium oxide(CaO) for evaluating exothermic reaction effects on the germina-tion of S. minor and S. sclerotiorum sclerotia. Results confirmedthe positive effects of exothermic reactions on sclerotia survival.Steam treatments were strongly effective on S. sclerotiorum onlyat the highest temperature conditions. However, adding CaO,survival was reduced drastically even with medium treatment(germination about 11%). S. minor was completely controlledwith medium treatment using CaO, while mild temperature con-ditions lowered germination to about 20%.

CHEMICAL RESISTANCE INDUCERS USED IN GLOBE AR-TICHOKE TO CONTROL SCLEROTINIA SCLEROTIORUM.P. Magro and E. Marcucci. Dipartimento di Protezione delle Piante,Università degli Studi della Tuscia, Via S. Camillo de Lellis, 01100Viterbo, Italy. E-mail: [email protected]

The aim of this study was to analyze the role of disease resist-ance inducers in globe artichoke to suggest the alternative use ofnew chemical compounds with a lower environmental impact.The most common lytic disease of globe artichoke is caused bySclerotinia sclerotiorum, against which three inducers were used,i.e. BTH (acibenzolar-S-methyl), BABA (b-aminobutyric acid)and KH2PO4 (potassium phosphate monobasic). Resistance in-ducers were administered to globe artichoke cvs C3 and Explot-er. The effect in resistance activation was determined by the assayof pathogenesis related (PR) proteins with reference to the activi-ty of chitinase, peroxidase and b-1,3-glucanase. Disease severityin treated plants was lower than in the controls artificially inocu-lated with S. sclerotiorum. An increase of peroxidase activity wasobserved in C3 plants inoculated and treated with KH2PO4 andin inoculated Exploter plants treated with KH2PO4 and BABA.BABA treatment increased chitinase and glucanase in C3, where-as in Exploter only glucanase was stimulated by KH2PO4. Themost abundant isoenzymatic pattern of glucanase was observedin inoculated Explorer plants treated with BABA. BABA andKH2PO4 induced a new isoform of peroxidase in Exploter,whereas in C3 this isoform was always observed. The isoenzymat-ic pattern of chitinase did not change among treated and inocu-lated plants. The experiments have shown that resistance induc-ers may have good prospects in the sustainable cultivation ofglobe artichoke.

MOLECULAR DETECTION OF ENDOPHYTIC FUNGI INGRAPEVINE. M. Martini, R. Musetti, S. Grisan, R. Polizzotto,S. Borselli and R. Osler. Dipartimento di Biologia Applicata allaDifesa delle Piante, Università di Udine, Via delle Scienze 208,33100 Udine, Italy. E-mail: [email protected]

Endophytes are microorganisms (fungi, bacteria, actino-mycetes) that live inside host plants without causing diseasesymptoms. Therefore, they are difficult to detect but identifica-tion by molecular means is becoming common. Epicoccum ni-grum Link and Aureobasidium pullulans (de Bary) Arnaud aretwo ubiquitous microfungi, frequently reported as endophytes ofdifferent crops, including grapevine. Fungal endophytes have

been isolated in PDA from surface sterilized leaf and shoot frag-ments of 15 vines. High molecular weight DNA was extractedfrom fresh mycelia following a modified procedure from Lecellierand Silar (Current Genetics 25: 122-123, 1994). ITS1, 5.8S rDNAand ITS2 were amplified by PCR using ITS1/ITS4 primers andsequenced. Two different E. nigrum strains and one A. pullulansstrain were isolated from grapevine tissues. Species-specificprimers for E. nigrum and A. pullulans were designed in variableregions of ITS1 and ITS2. Primers specificity was assessed byPCR using purified DNA from the more representative grapevinefungal endophytes. In order to know the frequency of the two en-dophytes in grapevine tissues, PCR with species-specific primerswas done on DNA extracted from leaves and shoots of 41grapevines collected in different localities of north-east Italy. Alltested plants were positive for both endophytes and the organismidentity was further confirmed by RFLP analyses of PCR prod-ucts. The RFLP patterns obtained from grapevine samples wereidentical to those of E. nigrum and A. pullulans reference strains.Thus, the molecular method described allowed a sensitive, specif-ic and reliable identification of the two endophytes in grapevine.

NEW REPORTS OF PHYTOPHTHORA HEDRAIANDRA, P.NIEDERHAUSERII AND P. TENTACULATA IN ITALY. P. Mar-tini1, S. Scibetta2, C. Allatta3, A. Pane3 and S.O. Cacciola4. 1Isti-tuto Regionale di Floricoltura, Via Carducci 12, 18038 Sanremo(IM), Italy. 2Dipartimento di Gestione dei Sistemi Agrari e Fore-stali, Università Mediterranea, Località Feo di Vito, 89060 ReggioCalabria, Italy. 3Dipartimento di Scienze e Tecnologie Fitosanitarie,Università degli Studi, Via S. Sofia 101, 95123 Catania, Italy. 4Di-partimento di Scienze Entomologiche, Fitopatologiche, Microbio-logiche e Zootecniche, Università degli Studi, Viale delle Scienze 2,90128 Palermo, Italy. E-mail: [email protected]

During a survey of ornamental plant nurseries in Sicily (south-ern Italy) and Liguria (northern Italy) three uncommon Phytoph-thora species, P. hedraiandra de Cock & Man in’t Veld (ITS-clade1), P. sp. “niederhauserii” (ITS-clade 7) and P. tentaculata. Krober& Marwitz (ITS-clade 1) were found. Phyotphthora species wereisolated from infected roots using selective media and axenic cul-tures were identified by sequence analysis of ITS regions of rD-NA. P. hedraiandra, P. niederhauserii and P. tentaculata were re-covered from potted plants of laurustinus (Viburnum tinus L.),Banksia sp. and Origanum sp., respectively. P. hedraiandra hasbeen reported previously on laurustinus in various Italian re-gions. At present, only species of Viburnum and Rhododendronare known to be susceptible to this species of Phytophthora. P.tentaculata has been reported previously on several ornamentalplants, including Chrysanthemum, Delphinium and Verbena. Re-cently, it was reported in Italy as a new pathogen of African Daisy(Gerbera jamesonii H. Bolus). However, to our knowledge, this isthe first report of P. tentaculata on Origanum. P. niederhauseriiwas identified as a separate species within the ITS-clade 1 on thebasis of DNA analysis, but it has not yet been described formally.The host range and distribution of this new species are not yetknown. To our knowledge,this is both the first report of P. nieder-hauserii in Europe and the first report of this species on Banksia.

INDUCTION OF UV-MUTANTS OF TRICHODERMAHARZIANUM TOLERANT TO ANTIFUNGAL METABOLITESOF FUSARIUM OXYSPORUM. M. Marzano1,2, M. Vurro2 and C.Altomare2. 1Dipartimento di Scienze Animali, Vegetali e dell’Ambi-ente, Università degli Studi del Molise, Via De Sanctis, 86100 Cam-pobasso, Italy. 2Istituto di Scienze delle Produzioni Alimentari del



CNR, Via Amendola 122/O, 70126 Bari, Italy. E-mail: [email protected]

The mycoherbicide Fusarium oxysporum strain FT2 is apathogen of Orobanche ramosa, a destructive parasitic weed ofvegetables in Mediterreanean countries. FT2 produces metabo-lites with antifungal activity, which may hamper its use in combi-nation with other fungal biocontrol agents. The inhibitory effectof the organic extract of FT2 cultures was assayed towards the an-tagonistic strain Trichoderma harzianum CFA16, resulting in 82%inhibition of CFA16 colonies grown on PDA supplemented with5% of FT2 extract. In order to improve the resistance of CFA16to antifungal compounds of FT2 and ameliorate the compatibilitybetween the two biocontrol agents, a UV-mutagenesis strategy wasadopted. Conidia of CFA16 were exposed to UV-C rays for 120seconds to obtain 80-85% of kill. Then, an aliquot of the irradiat-ed suspension was seeded on water agar supplemented with FT2extract. After 24 h, germinated conidia were isolated as presump-tive tolerant mutants and transferred on PDA + 5% FT2 extract.The colony growth of mutants was measured daily and comparedwith that of the wild type (wt). 200 presumptive UV-C mutantswere isolated and 25 mutants that exhibited up to 75% fastergrowth than the wt in the presence of 120 ppm of an FT2 antifun-gal metabolite were selected for further studies of biocontrol effi-cacy and ecological fitness. The development of strains with en-hanced tolerance to toxic metabolites is expected to lead to an im-provement of compatibility of CFA16 and biocontrol F. oxyspo-rum strains, as well as to an increase of competitive capability ofCFA16 towards phytopathogenic F. oxysporum. strains.

SANITARY SELECTION OF SWEET CHERRY. A. Materazzi,H. Bouyahia and E. Triolo. Dipartimento di Coltivazione e Difesadelle Specie Legnose “G. Scaramuzzi”, Sezione di Patologia Vege-tale, Università degli Studi, Via del Borghetto 80, 56124 Pisa, Italy.E-mail: [email protected]

The research project “Tutela e valorizzazione della ciliegia diLari”, supported by the “Fondazione Cassa di Risparmio diPisa”, was launched for preserving the genetic resources of sweetcherry (Prunus avium) in Lari (Pisa, Italy). A multidisciplinaryteam was established and 12 autochthonous sweet cherry culti-vars in danger of extinction were identified. The research wascarried out on 99 thirty-year-old plants, distributed in 10 or-chards. Composite samples of 15 leaves from each plant were col-lected in spring and tested by ELISA and RT-PCR for the pres-ence of the following viruses: Plum pox virus (PPV), Prunusnecrotic ringspot virus (PNRSV), Prune dwarf virus (PDV), Cherryleaf roll virus (CLRV), Apple mosaic virus (ApMV) and Applechlorotic leaf spot virus (ACLSV). Laboratory tests showed that76 of 99 plants (76.8%) were infected by at least one virus. Themost frequent virus was PDV, accounting 98.7% of the infections(75 of 76 infected samples); PNRSV was detected in 2 samplesand only in one case ACLSV was detected in mixed infectionwith PDV. PPV, CLRV and ApMV were not found. A subsequentanalysis, showed that the sour cherry (P. cerasus) rootstock moth-er plants, largely used in the area as a source seeds for forseedlings, was 100% infected by PDV. As reported, PDV istransmitted to seeds with about 70% efficiency, so we can con-clude that the high incidence of this virus (75,8%) can be mainlyattributed to the use of infected rootstocks.

COMPARATIVE ANALYSIS OF PLUM BARK NECROSISSTEM PITTING-ASSOCIATED VIRUS BY IC-PCR AND ELISA

DURING DIFFERENT SEASONS OF THE YEAR. S. Matic, M.Morelli and D. Boscia. Dipartimento di Protezione delle Piante eMicrobiologia Applicata, Università degli Studi and Istituto di Vi-rologia Vegetale del CNR, Sezione di Bari, Via Amendola 165/A,70126, Bari, Italy. E-mail: [email protected]

Plum bark necrosis stem pitting-associated virus (PBNSPaV)was monitored during different seasons over the year by the com-parative use of ELISA and immuno-capture (IC)-PCR. A field-grown tree of Japanese plum cv. Black Beaut, inoculated with anItalian PBNSPaV isolate (ASP), was sampled, testing 18 leaf sam-ples in spring, summer and autumn and cortical tissues from dor-mant branches in winter. Virus was detectable during all seasonsusing both techniques. The highest virus detection was found inspring by both techniques (100%). During summer and autumn,IC-PCR was more successful in virus detection (100%), thanELISA which gave positive reactions with 83% and 56% of thesamples, respectively. During winter, ELISA detected more sam-ples (94%), compared to IC-PCR (89%). The virus was ratheruniformly distributed in the tree canopy since it was detected inthe apical, middle and basal part of the branches with slight dif-ferences. Taking into account the estimated infection values on thewhole, both techniques gave satisfactory detections levels, for PB-NSPaV was detected in 97% of the samples by IC-PCR and in83% of the samples by ELISA. The use of both detection assaysseems to afford an efficient identification of PBNSPaV the wholeyear round.

WATERMELON MOSAIC VIRUS: THE PREDOMINANTVIRUS INFECTING WINTER MELON IN SOUTHERN ITALY.M. Meneghini1, C. Mennone2, M.L. Palermo3, G.F. Siddu4 andL. Tomassoli1. 1CRA, Istituto Sperimentale per la Patologia Vege-tale, Via C.G. Bertero 22, 00156 Roma, Italy. 2ALSIA, RegioneBasilicata, Strada Statale Jonica 106, km 448,2, 75010 Metaponto(MT), Italy. 3Regione Sicilia Assessorato Agricoltura e Foreste,U.O. 107, Via Toniolo 44b, 91026 Mazara del Vallo (TP), Italy.4Sardegna Agricoltura LAORE, Via Giovanni XXIII 99, 09096Santa Giusta (OR), Italy. E-mail: [email protected]

In Italy, Watermelon mosaic virus (WMV, genus Potyvirus, fam-ily Potyviridae) has been known since 1973 and it is one of themost common viruses affecting cucurbits in open-air crops togeth-er with Zucchini yellow mosaic virus (ZYMV) and Cucumber mosa-ic virus (CMV). However, WMV has been long considered a mi-nor pathogen because it induces very mild symptoms on the lavesand it seldom affects yield and quality of the fruits. In the lastyears, extensive outbreaks of a severe mosaic were observed onfield-grown winter melons (Cucumis melo L. var. inodorus) inSouthern Italy. Infected plants showed mosaic, vein-banding andmalformation of the leaves and discolorations of the fruits whichheavily reduced market quality. Samples from several infectedfields in Sicily, Basilicata and Sardinia, the main producing regionsof this crop, were analyzed by DAS-ELISA using commercial anti-sera against the most frequent mosaic-inducing viruses of cucur-bits, mainly belonging to the genus Potyvirus. Two years of assaysshowed the WMV is the prevalent causal agent of mosaic of win-ter melon (infection rates: WMV, 75%; CMV, 15%; other viruses,10%). WMV thus represents a real threat in those regions wherewinter melon is of major economic importance. In comparisonwith other cucurbit potyviruses, WMV occurs on a wide hostrange including species of other families and many weeds growingall year round. In addition several aphids species are vectors ofthis virus. Thus, it is necessary to implement appropriate sanitarymeasures, as insecticide treatments, culture practices, or providingresistant varieties to control WMV.



Research supported by the MiPAAF in the framework of theproject PROM.

EFFECT OF NATURAL PHENOLIC COMPOUNDS IN PEARSHOOTS INOCULATED WITH ERWINIA AMYLOVORA. P.Minardi1, S. Mucini2 and U. Mazzucchi2. 1Dipartimento di Mor-fofisiologia Veterinaria e Produzioni Animali, Università degli Studi di Bologna, Via Tolara di Sopra 50, 40064 Ozzano Emilia(BO), Italy. 2Dipartimento di Scienze e Tecnologie Agroambientali,Università degli Studi, Via Fanin 4, 40127, Bologna, Italy. E-mail:[email protected]

In recent years, investigations of the antimicrobial and antiox-idant properties of essential oils have shown that they can beused as natural additives to enhance the safety of fresh andprocessed fruits and vegetables. Most essential oils and their con-stituents are classified as GRAS (Generally Recognized As Safe)and their use is of great interest to the food industry. More specif-ically, phenolic components, such as thymol and carvacrol, are re-sponsible for the antibacterial properties of many essential oilsand appear to act as membrane permeabilizers. The antimicrobialactivity of carvacrol and thymol towards the causal agent of fireb-light disease, Erwinia amylovora (Ea), has been previously report-ed. The growth of this pathogen is completely inhibited by thesecompounds at the concentration of 50mM in double-layer agarplate tests, whereas, when the disc diffusion method is used, inhi-bition zones appear at the concentration of 35mM for both com-pounds. The minimum inhibitory concentration is 0.65 mM.From our previous studies in vitro we concluded that thymol hasa bactericidal effect towards Ea. In order to test the hypothesisthat carvacrol and thymol may induce resistance in pear shootsagainst Ea, both antimicrobials were sprayed at different concen-trations on shoots of three-year-old pear plants and, after 7 daysin the open, each shoot was inoculated with a bacterial suspen-sion. The plants, kept for 7 days in a climatic chamber, were in-spected for the presence of cortical cankers. Only thymol in-duced a slight protection against Ea. The procedures for the inplanta experiments are discussed.

INDUCED SUPPRESSIVENESS TO FUSARIUM OXYSPORUMf.sp. RADICIS LYCOPERSICI IN RECYCLED SUBSTRATES INCLOSED SOILLESS SYSTEMS. A. Minuto1, F. Clematis2, M.L.Gullino1 and A. Garibaldi1. 1Dipartimento di Valorizzazione eProtezione delle Risorse Agroforestali, Università degli Studi diTorino, Via Leonardo da Vinci 44, 10095 Grugliasco (TO), Italy.2Centro di Competenza per l’Innovazione in Campo Agro-ambien-tale (AGROINNOVA), Università degli Studi di Torino, Via Leonar-do da Vinci 44, 10095 Grugliasco, Italy. E-mail: [email protected]

Soilless tomatoes can be seriously damaged by Fusarium oxys-porum Schlect f. sp. radicis lycopersici the agent of Fusarium crownand root rot (FCRR). FCRR suppression can be achieved throughthe use of chemicals, selected substrates, composts and artificiallyintroduced. antagonistic microorganisms The aim of the currentstudy was to evaluate the natural capacity of an used substrate(rockwool, perlite and perlite-peat mix) to suppress FCRR. Newand used substrates, sampled from closed soilless systems, were ei-ther autoclaved or not, artificially inoculated with Fusarium oxys-porum f. sp. radicis lycopersici or not and, finally, sown with tomatoseeds cv Cuore di Bue. The effects of autoclaved/non autoclavedand used/new substrates on FCRR incidence were assessed byevaluating the symptoms of crown-rot on the root-stem transition

zone of tomato seedlings. Non autoclaved and inoculated usedrockwool, perlite and perlite-peat mix reduced FCRR incidencesignificantly when compared with non autoclaved and inoculatednew substrate. Autoclaved and inoculated used rockwool and per-lite-peat mix did not suppress FCRR, similarly to new and inocu-lated substrates. These results are in accordance with other re-search that, on cucumber/Pythium host/pathogen complex in aclosed rockwool soilless system, showed the key role of residentmicroflora in suppressing root rot disease. By contrast, recycledperlite suppressed FCRR incidence and severity also when it wassterilized before inoculation with the pathogen.

SEED HEALTH AND BIOCONTROL PERSPECTIVES OFSEED-BORNE PATHOGENS IN THE VEGETABLE PRODUC-TION CYCLE FOR QUALITY PRODUCTIONS. A. Mirotti, M.Sportelli and S. Gennai. C.D.F. s.r.l. Via Amendola 40, 48022 Lugo (RA), Italy. E-mail: [email protected]

Seed is the initial step of most vegetable crop productions.Italian legislation is not clear enough on the matter, as exhaustivesanitary standards on production of both conventional and bio-logical seeds, have not yet been issued. Extant rules on the quali-ty of nursery productions of vegetable species (D.M. April 14,1997) require absence of specific pathogens in propagation mate-rials, except for seeds. The aim of this study was to assess the san-itary condition of marketed seeds of tomato, cabbage, lettuce andmelon and the relationship between their health status and dis-ease incidence in an Emilia Romagna (northern Italy) nursery. Wealso evaluated the benefits of biocontrol agents available on themarket. Soil compost was integrated during the productive cyclein greenhouse nursery with commercial formulations of Tricho-derma harzianum (Rootshield® - Intrachem Bio Italia S.p.A.),Streptomyces (Mycostop® - Kemira Agro Oy), and mycorrhizaeplus Actinomycetes (Micosat F Or®-CCS Aosta). Analysesshowed that the percentage of seed samples positive for fungi,bacteria, and viruses were: (i) tomato: 5%, 10%, 2%; (ii) cab-bage: 6%, 7%; (iii) lettuce: 2%, 3%, 3%; (iv) muskmelon: 9%,2%, 1%, respectively. There was no significant difference be-tween biological and conventional seed samples. Testing madeduring the productive cycle in the nursery showed the presenceof diseases, particularly in plants coming from infected seed lots.The efficacy of biocontrol agents on plant growth was confirmed,for plants grew better in the nursery and had a longer productivecycle in the field. Mycorrhizal preparations with the addition ofActinomycetes showed a positive action on seeds germination.However, biocontrol of seed-borne plant pathogens was notenough to curb plant diseases in the nursery.

Work supported by the Emilia Romagna region (L.R. 28/98).

DEVELOPMENT OF A PCR-BASED METHOD FOR DETEC-TION OF BRENNERIA NIGRIFLUENS IN PERSIAN WALNUTPLANTS. C. Moretti and R. Buonaurio. Dipartimento ScienzeAgrarie e Ambientali, Università degli Studi, Borgo XX Giugno 74,06121 Perugia, Italy. E-mail: [email protected]

Shallow bark canker of Persian walnut (Juglans regia L.) incit-ed by Brenneria nigrifluens is considered one of the most danger-ous diseases for walnut timber production. Since a number ofbacterial species are frequently isolated from cankers, we devel-oped a PCR-based method for the specific detection of B. nigri-fluens. Rep-PCR performed with REP primers on B. nigrifluens,on bacteria we found associated with bark cankers (Moretti et al.,



J. Plant Pathol. 89: 211-218, 2007) and on Agrobacterium tumefa-ciens, Brenneria rubrifaciens, Erwinia amylovora, Pectobacteriumcarotovorum subsp. carotovorum, Pectobacterium crysanthemi,Pseudomonas syringae pv. syringae and Xanthomonas arboricolapv. juglandis, yielded an amplified product specific for B. nigriflu-ens, which was cloned and used for designing a pair of primers.The deduced aminoacidic sequence of the amplicon had an highlevel of identity with those of an exo-poly-a-D-galacturonosidaseof Yersinia enterocolitica subsp. enterocolitica and Pectobacteriumchrysanthemi. The primers permitted the specific amplification ofa 310 bp amplicon when the genomic DNA of 11 B. nigrifluensstrains, type strain included, was used as template. No PCR prod-ucts were obtained from bacteria associated with bark cankersand from any of the above-mentioned phytopathogenic species.Validation of this PCR assay to detect B. nigrifluens in infectedPersian walnut plants is under way

PARTIAL CHARACTERIZATION OF THE FOW1 GENE INVERTICILLIUM DAHLIAE ISOLATES FROM OLIVE TREES.F. Nigro, I. Pentimone, H. Barham and A. Ligorio. Dipartimentodi Protezione delle Piante e Microbiologia Applicata, Universitàdegli Studi, Via Amendola 165/A, 70126 Bari, Italy. E-mail: [email protected]

Verticillium dahliae Kleb., the causal agent of a vascular wiltdisease, is an economically important plant pathogen with world-wide distribution, affecting severely young olive trees. To date,the molecular mechanisms of pathogenicity and symptom induc-tion by V. dahliae in olive trees remain largely unexplored, al-though some pathogenicity genes of the fungus have been recent-ly identified and characterized. Improving the knowledge on V.dahliae pathogenicity could be useful for epidemiological studiesand for developing effective control strategies. Using primers (gi-Fow1F-giFowR), designed on a conserved hypothetical protein ofGibberella zeae (XM381597), a 550 bp DNA fragment (VerFow1)was amplified from DNA extracted from several V. dahliae iso-lates, cloned and sequenced. Basic local alignment search tool(BLAST) of the fragment VerFow1 showed a considerable ho-mology with a yeast and fungal hypothetical protein related to amitochondrial carrier protein (MCPs). This protein is known forits role in communication between mitochondrial matrix and cy-tosol, being essential in eukaryotic metabolism. In particular, se-quence analysis revealed a 96% identity with the correspondingregion of Fusarium oxysporum FOW1 gene (AB078975), encod-ing a mitochondrial protein that was identified and characterizedas a virulence determinant, specifically required for the coloniza-tion of melon plants. Trials to determine the role of the fragmentVerFow1 in the pathogenesis of V. dahliae on olive trees are inprogress. To the best of our knowledge this is the first report onthe characterization of a fungal hypothetical protein related tomitochondrial carriers in V. dahliae.

PRELIMINARY PATHOGENICITY TESTS OF FUSARIUMspp. ON ORNAMENTAL PALMS. M. Nigro, F. Mannerucci andN. Luisi. Dipartimento di Biologia e Patologia Vegetale, Universitàdegli Studi, Via G. Amendola 165/A, 70126 Bari, Italy. E-mail:[email protected]

In southern Italy ornamental palms belonging to the generaChamaerops and Phoenix showed wilting or general dieback insummer 2006. From fragments of leaves, roots and vascular tis-sues of symptomatic plants two Fusarium spp. were isolated,whose pathogenicity was tested on 2-year-old Chamaerops humilis

L. and Phoenix canariensis Hort. seedlings. Inoculum of bothstrain was prepared by flooding with 10 ml of sterile distilled wa-ter (SDW) the surface of a Petri dish containing a fungal culture,then scraping and collecting the aerial mycelium with a spatula.The resulting suspension was diluted with SDW and the conidialconcentration was assessed. Seedlings were inoculated with thesuspension according to three methods: injection with a syringe,spraying, root immersion. Control seedlings were inoculated withSDW. Disease development was recorded by counting the num-ber of symptomatic plants every 10 days. After 3 months symp-toms, consisting of chlorosis of the leaves followed by necrosisand dieback, were detected only on Phoenix seedlings inoculatedwith both fungal isolates, while Chamaerops seedlings and con-trols showed no symptoms. Among methods of inoculation, rootimmersion proved to be the most effective based on of the num-ber of infected seedlings. Positive re-isolations were obtainedmostly from roots, thus suggesting that the two Fusarium isolatespossess some host and tissue specificity.

INDOLE-3-ACETIC ACID PRODUCTION BY FUSARIUMSOLANI ISOLATED FROM KIWIFRUIT. P. Nipoti1, A. Prodi1,C. Oliver1, R. Baraldi2, F. Rapparini2 and A. Pisi1. 1Dipartimentodi Scienze e Tecnologie Agroambientali, Alma Mater StudiorumUniversità degli Studi, Via Fanin 42, 40127 Bologna, Italy. 2Istitutodi Biometeorologia del CNR, Via P.Gobetti 10, 40129 Bologna,Italy. E-mail: [email protected]

Kiwifruit elephantiasis is characterized by hypertrophy of thetrunk. Fusarium solani has been frequently isolated from affectedplants and its involvement in the disease is being tested withpathogenicity trials underway. F. solani is known for its abilitysynthesize indole-3-acetic acid (IAA). This auxin is essential forcell growth, affecting both cell division and cellular expansion,and may promote axial elongation, lateral or isodiametric expan-sions at the tissue level. Monosporic cultures of 14 strains of F.solani were grown on agar-potato-dextrose (PDA) for determin-ing their biological features (colonization ability and pigmenta-tion) and the amount of IAA production. For in vitro tests, 3 cmlong kiwifruit sprouts were placed on F. solani-colonized PDAand the extent of tissue necrosis was evaluated. Substrate pig-mentation induced by the fungus was studied at 25°C. Determi-nation of free IAA was done by a capillary gas-chromatography-mass spectrometry-selected ion monitoring (GC-MS-SIM) usinga Hewlett Packard 5890-5970 System. Half of the 14 isolatesstudied showed extensive tissue colonization, whereas most ofthem pigmented PDA with various levels of yellow/red tinge.IAA production was quite variable for all fungal strains. The highability to colonize kiwifruit tissues by F. solani strains rarely cor-responded to a high IAA production on PDA, except for two ofthe strains. These results call for further investigations on the re-lationships between host tissue colonization and IAA productionby F. solani strains.

ACETIC AND PERACETIC ACID TREATMENT OF OR-ANGES TO CONTROL POSTHARVEST DECAY. C. Oliveri, A.Bonaccorsi and V. Coco. Dipartimento di Scienze e Tecnologie Fi-tosanitarie, Università degli Studi, Via S. Sofia 100, 95123 Catania,Italy. E-mail: [email protected]

Post-harvest decay management has long relied on syntheticchemical fungicides. Recently, interest in ‘natural’ alternatives hasbeen growing because they are effective against post-harvestpathogens of many fruits (pome and stone fruits, grapes, oranges,



plums, strawberries). In this study, the effects of acetic (AA) andperacetic (PAA) acid concentration on conidial germination ofPenicillium digitatum and Botrytis cinerea and the application ofAA and PAA for controlling decay of orange fruits in semi-com-mercial conditions were evaluated. AA (0.5%) reduced B. cinereaconidia germination below 15.6% after 3 h while at its highestconcentration (3%) germination was totally inhibited after 3 and6 h. Germination of P. digitatum conidia was reduced to 1.7% af-ter 6 h treatment with 3% AA. A reduction of germ tube elonga-tion was observed with all tested concentrations. PAA was muchmore active than AA for the lowest PAA concentration (0.1%)totally inhibited P. digitatum and B. cinerea conidia germination.Oranges were treated in the packinghouse as follows: (i) 3% AAspray; (ii) 3% AA dip; (iii) imazalil spray + wax (400ml/100Kg).After 2 weeks storage, 3% AA reduced decay incidence ofsprayed fruits to 7.4%, compared with fungicide treated fruits.Since the fruits treated with AA showed peel browning, phyto-toxic effects were evaluated in various ways. Dipping was effec-tive for suppressing fungal decay but not browning. When cv.Tarocco fruits were sprayed with 2% AA and dried at 35°C, nobrowning was observed. Likewise, 2 and 3% PAA treatments in-duced no browning.

REAL-TIME PCR SYSTEMS BASED ON SYBR® GREEN IAND TAQMAN® TECHNOLOGIES FOR SPECIFIC QUANTI-TATIVE DETECTION OF PHOMA TRACHEIPHILA IN IN-FECTED CITRUS. M. Orrù1, M. A. Demontis1, S. O. Cacciola2,V. Balmas1, V. Chessa1, F. Raudino3, G. Magnano di San Lio3

and Q. Migheli1. 1Dipartimento di Protezione delle Piante, Unitàdi Ricerca Istituto Nazionale Biostrutture e Biosistemi, Universitàdegli Studi, Via E. De Nicola 9, 07100 Sassari, Italy. 2Dipartimentodi Scienze Entomologiche, Fitopatologiche, Microbiologiche Agra-rie e Zootecniche, Università degli Studi, Viale delle Scienze 2,90128 Palermo, Italy. 3Dipartimento di Gestione dei Sistemi Agrarie Forestali, Università Mediterranea, Località Feo di Vito, 89060Reggio Calabria, Italy. E-mail: [email protected]

Real-time PCR assays based on SYBR® Green I and TaqMan®

technologies were developed for in planta detection and quantifi-cation of Phoma tracheiphila, the agent of citrus “mal secco”.Primers and hybridization probe were designed on the internaltranscribed spacer (ITS) region of the nuclear rRNA genes. Real-time PCR assays were compared with a classic isolation methodin two separate experiments carried out on 6- and 24-month-oldsour orange seedlings, artificially inoculated with a conidial sus-pension of the pathogen. Both technologies made it possible tofollow the progression of infection by P. tracheiphila, enabling de-tection and quantification of the target fungus prior to the devel-opment of symptoms. Detection limit was 10 copies of the clonedtarget sequence and 15 pg of genomic DNA extracted from fun-gal spores. The presence of non-target fungal DNA had no effecton the specificity of the assay, but resulted in a 10-fold reductionof sensitivity. Total inhibition of the reaction occurred when coni-dia of the target pathogen were mixed with an organic soil sub-strate before extracting DNA by using the standard protocol,while an alternative purification kit resulted in a significant de-crease in sensitivity. Compared to classic methods, real-time PCRproved faster and easier to perform and showed a higher sensitiv-ity. These results suggest that real-time PCR has a great potentialfor early diagnosis of “mal secco” disease and for quantitative es-timation of fungal growth within host tissue.

Work funded by the European Union within the frameworkof INTERREG III A Italy-France-“Isole” (Project acronym: CIT-RUS).

NEW PLUM POX VIRUS FOCI IN CAMPANIA AND BASILI-CATA (SOUTHERN ITALY). R. Pacella1, G. Massa2, A. Fanigli-ulo1, S. Comes1 and A. Crescenzi1. 1Dipartimento di Biologia,Difesa e Biotecnologie Agro-Forestali, Università degli Studi dellaBasilicata. Via dell’Ateneo Lucano 10, 85100 Potenza, Italy.2Bioagritest S.r.l., Zona PIP Lotto E2, 85010 Pignola (PZ), Italy. E-mail: [email protected]

During the last decade stone fruits orchards in Southern Italyhave suffered extended and severe outbreaks of Sharka diseasemainly caused by Plum pox virus (PPV) D isolates. An extensivesurvey in several stone fruit orchards of Salerno (Campania) andMatera (Basilicata) provinces, was conducted aiming at the iden-tification of new PPV foci over an area of 500 ha. Nearly 20,000plants between apricot, plum, peach and nectarines were ob-served for the presence of symptoms. About 1000 plants thatshowed symptoms of viral infection were analysed by DAS-ELISA using PPV-specific polyclonal antibodies, 2% of whichproved to be infected by PPV. Virus isolates responsible of the in-fection were characterised by biological indexing, by ELISA us-ing monoclonal antibodies specific to the four strains and finallyby RT-PCR, followed by AluI and RsaI RFLP analysis. All viralisolates belonged to the PPV-D subgroup. Two PPV-D isolatesfrom different provinces, Salerno and Matera, selected for molec-ular characterisation, consisting in the amplification, cloning andsequencing of the CP gene, shared a similarity of about 100%, in-dicating that the identified foci were caused by the same PPV iso-late. In May 2007, two new severe PPV foci were identified atNocera Inferiore (SA) and on the Ionian coast of Basilicata, bothon apricot cv. Ninfa. Virus isolates responsible for infection areunder investigation.

NEW ADVANCES ON IN VITRO ANTIVIRAL CHEMOTHER-APY. A. Panattoni and E. Triolo. Dipartimento Coltivazione eDifesa delle Specie Legnose “G. Scaramuzzi”, Sezione di PatologiaVegetale, Università degli Studi, Via del Borghetto 80, 56124 Pisa,Italy. E-mail: [email protected]

The detrimental effects of virus infections on the quantity andquality of the yield, highlight the importance of virus-free propa-gation material and underline the need to produce virus-freeplant material for the nuresry industry. Since 1992, we investigatethe antiviral activity of several drugs for improving virus eradica-tion, as chemotherapy offers wide alternative possibilities. At thebeginning, our research was focused on the use of three wellknown synthetic nucleotide analogues: ribavirin, DHT and DH-PA. Results were obtained in the control of Plum pox yvirus andPrunus necrotic ringspot virus on a selection of Prunus cerasiferaexplants. New antiviral groups characterized by different actionmechanism were investigated more recently, i.e. inosinemonophosphate dehydrogenase (IMPDH), S-adenosilhomocys-teine hydrolase (SAH) and neuraminidase (NA) inhibitors. A firstscreening was conducted on the in vitro system Nicotianatabacum cv Xanthi/Cucumber mosaic virus treated with drugs ofthese groups, obtaining positive results with all combinations (re-ported at the 13th Annual Meeting of SIPaV). New trials weretherefore carried out for the sanitation of grapevines with poorsanitary condition. Treatments gave a good control of Grapevineleafroll-associated virus 3 infection on in vitro-grown cv. San-giovese explants, yielding 100% free explants when NA in-hibitors were used. In vitro-grown cv. Sagrantino plantlets infect-ed by Grapevine virus A were treated with the same compoundsand successful virus eradication was obtained with the combina-tion of IMPDH and SAH inhibitors.



EVALUATION OF PEAT MIXTURE SUPPRESSIVENESSAGAINST RHIZOCTONIA SOLANI. C. Pane, C. Chiantese, G.Bonanomi, L. Cozzolino, V. Antignani, G. Puopolo, A. Zoinaand F. Scala. Dipartimento di Arboricoltura, Botanica e PatologiaVegetale, Università degli Studi di Napoli “Federico II”, Via Uni-versità 100, 80055 Portici (NA), Italy. E-mail: [email protected].

Sphagnum peats generally has no suppressive effects on soil-borne pathogens, although in few cases it was reported to reducethe incidence of seedling damping-off caused by Rhizoctoniasolani and Pythium ultimum. Previous studies related the sup-pressive capability of peats to their content of carbohydrates andreadily degradable organic compounds, which sustain the activityof antagonistic microorganisms. This hypothesis was corroborat-ed by the observation that light peats, which are rich in carbohy-drates, support a higher microbial activity compared to darkpeats, that are consistently conducive. In this study four organicamendments (i.e. A= mixture of light and dark peats; B= peats +green plant residues; C and D= peats enriched with different mi-cronutrients), were analyzed for a number of physical, chemical,and biological properties, including the suppression of damping-off caused by R. solani. Disease suppression varied largely amongthese four peat mixtures, according to the following ranking:B≥C>A>>D. Peat suppressiveness was positively related to itsenzymatic activity (i.e. FDA, endochitinase, biase, glucanase andNAGase), pH, electrical conducivity, N organic, actinomycetespopulation density and phytotoxicity level. Only amendment Bwas found to be phytoxic using the Lepidium sativum test. Thepresence of undecomposed plant residues in B probably sus-tained the activity of antagonistic microbes but, at the same time,induced substrate phytotoxicity. By contrast, C suppressivity wasrelated to the abundant presence in the mixture of Trichodermaspecies. Our results indicate that the combined application ofpeats and suppressive materials (e.g. crop residues at lowdosages) is promising for container-produced plants.

CONTROL OF PLANT PATHOGENS BY USING A COMPOSTTEA. C. Pane1, F. Valentini2, G. Bonanomi1, L. Cozzolino1, V.Antignani1, G. Puopolo1, A. Zoina1 and F. Scala1. 1Dipartimentodi Arboricoltura, Botanica e Patologia Vegetale, Università degliStudi di Napoli ”Federico II”, Via Università 100, 80055 Portici(NA), Italy. 2Ge.Se.Nu. S.p.A., Via della Molinella 7, 06125 PonteRio (PG), Italy. E-mail: [email protected]

Compost tea is increasingly being used to control plant dis-eases. Aerated compost teas are highly concentrated aqueous mi-crobial suspensions obtained from the decomposition of com-posts in water for a defined period of time. Effective disease con-trol with compost teas has been obtained for several air-bornepathogens such as Sphaerotheca spp., Venturia spp. and Alternar-ia spp. In this study, a compost tea was analysed for the abililityto suppress the following diseases: grey mould of bean and toma-to caused by Botrytis cinerea, bacterial speck of tomato byPseudomonas syringae pv tomato (Pst), and damping-off of Lepid-ium sativum by Rhizoctonia solani. This tea was produced by theaerobic water decomposition of a compost obtained from a mix-ture of municipal organic waste, green pruning residues, and to-bacco and aromatic plant refuses (6:4:2, respectively). Composttea contained 2,6 x 109 c.f.u. ml–1 of culturable bacteria (fluores-cent Pseudomonads were absent) and 1,15 x 105 c.f.u. ml–1 cultur-able filamentous fungi (almost exclusively present as Aspergilluswentii). Tea was not phytotoxic in soil and foliar applications; in-hibited B. cinerea conidial germination and suppressed leaf lesiondevelopment on bean and tomato and significantly reduced

severity of bacterial speck on tomato plants. In contrast, soildrenching applications were unable to control Rhizoctonia dump-ing-off. From these results, it appears that the compost tea has apotential for useful applications in plant disease management.

FUNGAL CONTAMINATION OF AIR AND WHEAT GRAINSAMPLES FROM FIELD AND STORAGE ENVIRONMENTS.S. Panebianco, A. Bonaccorsi, A. Vitale, R. La Rosa and G.Cirvilleri. Dipartimento di Scienze e Tecnologie Fitosanitarie, Uni-versità degli Studi, Via S. Sofia 100, 95123 Catania, Italy. E-mail:[email protected]

Considering the risk that mycotoxin contaminations representfor human health, a study was undertaken to estimate the con-tamination of wheat (Triticum durum L.) grains and the air ofstorage warehouses by potential mycotoxin-producing fungi inSicily. Samples of air and wheat grains were collected from thefield, warehouses and farmer’s cooperative storey-buildings andexamined to estimate the total fungal population. Fusarium, Al-ternaria, Aspergillus and Penicillium spp. were isolated and iden-tified. Fusarium and Alternaria spp. were predominant in the airand grain samples from the field, whereas Penicillium and As-pergillus spp. were predominant in the air and grain samples fromwarehouses and storey-buildings. Among Aspergillus spp., A.ochraceus and A. niger were the most common. Antagonismagainst Aspergillus isolates by different bacterial strains was inves-tigated. Bacteria and their cell-free-filtrates strongly inhibited A.ochraceus and A. flavus isolates in in vitro screening. In in vivoscreening of wheat grains, fungal growth was markedly inhibitedduring 15 days of storage. The in vitro and in vivo assays showedthat A. ochraceus isolates were more sensitive than those of A.flavus to the antagonistic activity of bacterial strains. Pseudo-monas syringae 48SR2 and Burkholderia gladioli DISTEF strainsshowed the strongest antagonistic activity in both assays. Resultsshow that wheat contamination with potentially mycotoxigenicfungi is a risk present both in the open field and storage environ-ments in Sicily. Moreover, biological control by antagonistic bac-teria should be more deeply investigated.

A SEVERE OUTBREAK OF TOMATO INFECTIOUSCHLOROSIS VIRUS IN LETTUCE AND ESCAROLE INSOUTHERN ITALY. G. Parrella1 and F. Filella2. 1Istituto per laProtezione delle Piante del CNR, Via Università 133, 80055 Porti-ci, Italy. 2ARSSA, Agenzia Regionale per lo Sviluppo e per i Serviziin Agricoltura, 87027 Paola (CS), Italy. E-mail: [email protected]

Tomato infectious cholorosis virus (TICV), a member of thegenus Crinivirus, family Closteroviridae, is the causal agent of yel-lowing diseases in several vegetable crops grown under protectedenvironments. It is a phloem-limited bipartite genome virus,transmitted by the greenhouse whitefly Trialeurodes vaporariorumin a semi-persistent manner. In 2005 and 2006, a severe disease oflettuce cv. Romana (Lactuca sativa var. longifolia) and escarole(Cichorium endivia var. latifolium) characterized by intervenialyellowing of the leaves was observed in Calabria (Southern Italy).The percentage of affected plants ranged between 70 and 80%for both crops. Leaf samples collected from symptomatic plantswere positive in RT-PCR assays when degenerate primers forcriniviruses were used. The identity of the virus was then assessedusing TICV-specific primers and probe. Transmission tests withviruliferus T. vaporariorum collected form infected lettuce and es-carole, reproduced the symptoms on healthy plants after aboutone month from exposure to the insects. Based on biological and



molecular data, TICV was for the first time detected in lettuce inItaly and for the first time in escarole, which could consequentlyrepresent a new concern for these crops, at least in SouthernItaly. Although the distribution of TICV and its impact on lettuceand escarole production need to be further investigated in Italy,these data confirm that whitefly- transmitted viruses are increas-ing their importance worldwide, becoming a potential limitingfactor for many crops, also in some previously unaffected temper-ate areas of the Mediterranean basin.

EFFECT OF TRICHODERMA sp. ON SPORULATION OFSTEMPHYLIUM VESICARIUM, THE CAUSAL AGENT OFPEAR BROWN SPOT. E. Pattori, S. Cavagna, K. Righi and V.Rossi. Istituto di Entomologia e Patologia vegetale, Università Cat-tolica del Sacro Cuore, Via Emilia Parmense 84, 29100 Piacenza,Italy. E-mail: [email protected]

It is known that fallen pear and weed leaves support the pro-duction of conidia and ascospores of Stemphylium vesicarium andits teleomorph Pleospora allii, thus representing the inoculumsource for infections during the season. It was also shown that bi-ological control based on application of Trichoderma reduces theproduction of ascospores. In this work, the effect of Trichodermaformulations on suppression of conidial production was investi-gated under both environment-controlled and natural conditions.Pear and crabgrass (Digitaria sanguinalis) leaves were inoculatedwith S. vesicarium or Trichoderma or both fungi, and the produc-tion of conidia was determined microscopically for six weeks.BCAs were able to colonize both substrates and produced abun-dant Trichoderma spores, with significant differences betweenformulations. BCAs reduced spore production by S. vesicarium,by about 99% after 6 weeks. Trichoderma formulations were alsoapplied in spring on a grassy area naturally converted into a wild-flower meadow that was inoculated with S. vesicarium, and cov-ered with an inoculated pear leaf litter. Conidia were continuous-ly trapped from spring to autumn with spore traps placed abovethe soil. In one of two years, BCAs significantly reduced theamount of conidia trapped compared to the untreated control.

GENETIC CHARACTERIZATION BY AFLP OF BACILLUSLICHENIFORMIS STRAINS, POTENTIAL BIOCONTROLAGENT OF SOIL-BORNE PATHOGENS. I. Pentimone, M. Fer-rara, A. Ligorio, A. Ippolito and F. Nigro. Dipartimento di Protezione delle Piante e Microbiologia Applicata, Università degliStudi, Via Amendola 165/A, 70126 Bari, Italy. E-mail: [email protected]

Bacillus licheniformis, a Gram-positive, spore-forming soilbacterium, is used in the biotechnology industry to produce en-zymes, antibiotics, and other biochemicals. The species synthe-sizes a range of extracellular products that may contribute to nu-trient cycling in nature. Moreover, in recent years interest in bio-control of soil-borne plant pathogens has been encouraged bytrends in agriculture towards a greater sustainability. There areclear evidences that several bacteria and their products play a keyrole in the suppression of various soil-borne plant pathogens. Thebiocontrol agent B. licheniformis, strain MBBL1, proved to be ef-fective in reducing the inoculum density of Verticillium dahliae inthe rizosphere of olive trees. However, the introduction of antag-onistic microbes in the soil calls for the necessity of monitoringtheir dispersal and interactions with the natural occurring rhizos-phere microbes. Therefore, in this study the amplified fragmentlength polymorphism (AFLP) technique was applied and evaluat-

ed to discriminate strain MBBL1 from a group of highly relatedBacillus spp. isolates from the olive rhizosphere. For AFLP analy-sis, the total purified genomic DNA from 100 isolates was digest-ed with EcoRI and MseI and ligated to constructed adapters. Re-stricted/ligated fragments were pre-amplified using primers com-plementary to the adapters, then selectively amplified usingprimers exceeding three nucleotides beyond the 3'-end of theadapters. Finally, amplified products were resolved with poly-acrylamide gel electrophoresis and were silver stained. Themethod enabled the identification of the targeted strain even af-ter soil treatment. Moreover, the AFLP method allowed a prelim-inary characterization of B. licheniformis strains at the intra-sub-specific population level.

INFLUENCE OF CLIMATIC CONDITIONS AND PHENO-LOGICAL STAGES ON AIR POLLUTION DAMAGES TOWHEAT VARIETIES. V. Picchi1, S. Quaroni2, M. Saracchi2, P.Viola3, M. Iriti1,2 and F. Faoro1,2. 1Istituto di Virologia Vegetaledel CNR, Sezione di Milano, Via Celoria 2, 20133 Milano, Italy.2Istituto di Patologia Vegetale, Università degli Studi, Via Celoria2, 20133 Milano, Italy. 3Apsovsementi, 27058 Voghera, (PV), Italy.E-mail: [email protected]

A three year survey on wheat performance in the Po Valley(northern Italy) was carried out, correlating climatic conditions(temperature and rainfall) and tropospheric ozone levels with theevolution and severity of a peculiar symptomatology due to airpollution, very likely ozone, as assessed with open top chambers(OTC) facilities and cytochemical investigations. Symptoms con-sisted of small chlorotic spots, usually appearing in the lastdecade of April and evolving, in some varieties, in ellipticalnecrotic lesions. The surveys (March-June of each year) showedthat symptom severity, besides being related to the sensitivity ofeach variety, depended also on the phenological stage in whichcritical ozone AOT40 (Accumulated dose Over a Threshold of 40ppb) levels were reached. In 2007, a year characterized by a mildwinter and heavy early spring rainfalls, enhancement of symptomseverity was observed. In this year, even tolerant varieties, such asGuarni (bread wheat) and Dylan (durum wheat), showedchlorotic spots already in the first decade of April, even thoughAOT40 levels were similar to those recorded in the previousyears. This could be related to an earlier occurrence of tilleringand, in turn, to the enhanced pollutant uptake in this period ofmaximum growth rate. Crop yield data of six bread and two du-rum wheat varieties indicated that symptom severity is not strictlycorrelated with productivity, though trials with OTC demonstrat-ed that filtered air led to 10-20% enhancement of productivity.

FUNGAL PATHOGENS OF WEEDS GROWN IN SOILAMENDED WITH OLIVE MILL WASTE BY-PRODUCTS.A.M. Picco1, M. Rodolfi1, S. Chinaglia1, L. Pecoraro2, E.Salerni2 and C. Perini2. 1Dipartimento di Ecologia del Territorio,Sezione di Micologia, Università degli Studi, Via S. Epifanio 14,27100 Pavia, Italy. 2Dipartimento di Scienze Ambientali “G. Sarfat-ti”, Università degli Studi, Via P.A. Mattioli 4, 53100 Siena, Italy.E-mail: [email protected]

Different soil amendments with olive mill by-products (olivehusk and olive mill waste mixture arranged according to MATRe-FO procedure developed by ISAFoM-CNR) were compared inan experimental trial conduced in the Botanical Garden of theUniversity of Siena, in April 2006. In the first year of the trialplots were analyzed for their bacterial and fungal population as



well as natural weed colonization; soil samples were also collectedfor evaluating carbon evolution. In the context of this agronomictrial, the present study reports the results of a phytosanitary in-vestigation carried out on the spontaneous vegetation grown onamended soils. Some phytopathogenic species were detectedamong the different phylloplane fungi identified from randomlycollected leaves with necrosis. During winter sampling, Cercospo-ra medicaginis, the causal agent of “summer black stem and leafspot”, was isolated from Trifolium pratense grown on bothamended and non amended soils. In the next sampling, (spring2007), the disease appeared only in T. pratense plants grown incontrol plots. A similar picture was observed on the leaves ofHolcus lanatus, colonized by the cosmopolitan pathogen Bipolariscynodontis. The only fungal pathogen detected on plants grownon amended plots was Ramularia pratensis, which was frequentlyisolated from leaf spots of Rumex crispus. The frequent presenceof Trichoderma strains in amended soils seems worth of furtherinvestigations to confirm the protective role observed.

SENSITIVITY AND SPECIFICITY EVALUATION OF REAL-TIME PCR PROTOCOLS IN THE DIAGNOSOS OF GRA-PEVINE YELLOWS. L. Pivetti1, C. Ratti2 and E. Stefani1. 1Di-partimento di Scienze Agrarie e degli Alimenti, Università di Mode-na e Reggio Emilia, Via J.F. Kennedy 17, 42100 Reggio Emilia,Italy. 2Dipartimento di Scienze e Tecnologie Agro-ambientali, Uni-versità degli Studi, Via G. Fanin 44, 40127 Bologna, Italy. E-mail:[email protected]

In the last decade, grapevine yellows outbreaks became in-creasingly common in the vineyards of Emilia Romagna (northernItaly). At least two phytoplasmas have been associated with theseoutbreaks i.e. Aster yellows (16SrI) and Stolbur (16SrXII). Diag-nosis of these pathogens is somewhat troublesome, due to theiruneven distribution in the vines and to the nature of the samplesfor testing (plant tissues and insect vectors). In general it is recog-nised that nested PCR, which is a common diagnostic techniquefor grapevine yellows, might have a reduced sensitivity, whereasRealTime-PCR is more sensitive. This study aimed at comparingnested PCR with two RealTime-PCR protocols using a TaqManprobe and the Sybr-Green chemistry, respectively. Test sampleswere grapevine tissues and insect vectors. Results showed thatnested PCR was less sensitive than RealTime-PCR techniques. Ofthese, the protocol based on the TaqMan probe had the highestspecificity, whereas the SybrGreen chemistry protocol gave betterresults as to sensitivity. These results suggest the use of the Real-Time-PCR protocol with the TaqMan probe for certification ofnursery material and for checking symptomless plant materialfrom the field.

THE COMBIMATRIX PLATFORM FOR MICROARRAYANALYSIS: GENE EXPRESSION IN RESISTANT AND SUS-CEPTIBLE GRAPE GENOTYPES DURING PLASMOPARAVITICOLA INFECTION. M. Polesani1, D. Glissant1, D. Damet-to1, A. Ferrarini1, F. Desario1, A. Kortekamp2, M. Pezzotti3, M.Delledonne1 and A. Polverari3. Dipartimento Scientifico e Tecno-logico, Università degli Studi, Strada Le Grazie 15, 37134 Verona,Italy. 2Institute of Special Crop Cultivation and Crop Physiology,University of Hohenheim, 70593 Stuttgart, Germany. 3Dipartimen-to di Scienze, Tecnologie e Mercati della Vite e del Vino, Villa Ot-tolini-Lebrecht, 37029 San Floriano di Valpolicella (VR), Italy. E-mail: [email protected]

A comprehensive analysis of transcriptional changes associat-

ed with the infection process of Plasmopara viticola in susceptible(Vitis vinifera cv. Pinot Noir) and resistant (Vitis riparia cv. Gloirede Montpellier) grapevine genotypes has been undertaken by mi-croarray analysis, at different times after infection. The analysiswas performed on the newly developed Combimatrix platform atthe University of Verona on a Grape chip carrying 24562 specificprobes in triplicates from assembly of Tentative Consensus of thelast TIGR Vitis vinifera Gene Index release 5.0, and from non re-duntant genomic sequences produced by the genome annotationin the International Grape Genome Project. Combimatrix tech-nology is characterized by an exclusive in situ oligo (up to 40mers) synthesis driven by electrochemistry and by the reusabilityof the same microarray, all factors that confer high flexibility tothe system and reduce drastically the costs of microarray analysis.Leaves of resistant and susceptible grape plants grown in vitrowere infected with P. viticola or treated with distilled water as acontrol, and collected at 12, 24, 48 and 96 h post-inoculation.Hybridisations were carried out with samples deriving from threeindependent replicates. Differentially expressed genes were se-lected using the multi experiment Significance Analysis of Mi-croarray test, and gene clustering was performed using Genesissoftware.

DIFFUSION OF THIELAVIOPSIS TRUNK ROT IN IMPORT-ED DATE PALM AND DETECTION OF HEART ROT BY RE-SISTOGRAPH AND TREE TOMOGRAPHY PROCEDURES.G. Polizzi1, I. Castello1, A. Vitale1 and C. Fruscione2. 1Diparti-mento di Scienze e Tecnologie Fitosanitarie, University of Catania,Via S. Sofia 100, 95123 Catania, Italy. 2Studio Verde S.A.S. ViaCervino 42/C, 10155 Torino, Italy. E-mail: [email protected]

During 2006 and 2007, a survey was conducted in nurseries,private and public gardens of eastern Sicily for assessing the dis-tribution of heart rot caused by Thielaviopsis paradoxa on matureplants (5 to 8 meters in hight) of date palm (Phoenix dactylifera)from Egypt. Symptoms of heart rot were observed in several pri-vate and public gardens of the Catania and Ragusa provinces af-fecting a high percentage (40-80%) of the plants. Rotting of theupper half of the trunk caused a sudden collapse of the canopy,which had an apparently normal aspect. Infected plants died 2-3years after transplanting. Symptoms were not detected on ligni-fied and external fibres. Isolations from internal tissues adjacentto the rotten areas made on carrot agar with 500 µl streptomycinsulphate and on acidified (lactic acid; pH 3.6) potato dextroseagar, yielded frequently Thielaviopsis paradoxa colonies. Internaldecay of symptomless palms was assessed by a drilling resistance-measuring procedure with resistograph (IML-RESI B 400) andby Tree Tomography (Arbotom® Rinnteck). Transverse cross-sections of plants with no external symptoms confirmed instru-mental analysis and revealed a brown rot of non-lignified or light-ly lignified tissues. These results show that instrumental analysismay be used for diagnosis of heart rot. In any case, it is recom-mended to avoid importation of mature date palms from knowninfected areas due to symptomless infections by T. paradoxa.

A NEW EMERGENCE IN SOILLESS TOMATO CULTURES INSICILY: VASCULAR AND PITH DISCOLORATION CAUSEDBY PSEUDOMONAS FLUORESCENS AND P. PUTIDA. G.Polizzi, M.A. Dimartino, S. Panebianco and G. Cirvilleri. Dipar-timento di Scienze e Tecnologie Fitosanitarie, Università degli Stu-di, Via S. Sofia 100, 95123 Catania, Italy. E-mail: [email protected]

During February-May 2007, a widespread whitering was ob-



served in seven tomato soilless cultures under plastichouses in theCatania, Siracusa and Ragusa provinces (eastern Sicily). Trans-verse sections of the stem of tomato cvs Piccolo, Tyty, Jessica,Shiren, Desiderio, and Clave revealed a yellow, pink or browndiscoloration of the tissues, especially at the crown level. Thesesymptoms, resembling those induced by Fusarium oxysporum,were detected on most of the plants (50-100%). Pith necrosis andbrown spots on the stem surface were detected sporadically onlyin a plastic-house. Fusarium oxysporum f. sp. radicis-lycopersiciwas seldom isolated on potato dextrose agar (PDA) or acidifiedPDA (lactic acid; pH=3.6). By contrast, Gram negative bacteriawere always isolated from the internal stem tissues of tomatoplants on nutrient agar and King’s medium B. One hundred bac-teria isolates were purified and used for further studies. Theyshowed the LOPAT characters of group Vb (++-+-) and groupVa (-+-+-) and were identified as Pseudomonas fluorescens (biovarI) and Pseudomonas putida (biovar A) on the basis of morpholog-ical, physiological and biochemical tests. The identity of repre-sentative strains was confirmed by the nutritional profile ob-tained with Biolog analysis (Microbiolog TM System Release 4.2;Biolog, Inc., Hayward, CA, USA). Koch’s postulates were ful-filled using cvs Tyty and Piccolo confirming the pathogenicity ofthe isolates. P. fluorescens (biovar F) or P. corrugata were isolatedonly occasionally from symptomatic stems. In our conditions,vascular and pith discoloration caused by P. fluorescens and P.putida can be confused with symptoms induced by F. oxysporum.

OCHRATOXIN A CONTAMINATION OF MUSTS ANDWINES: OBSERVATIONS ON PREDISPOSING FACTORS INTHE VINEYARDS. S. Pollastro1, C. Dongiovanni2, C. Giampao-lo2, R.M. De Miccolis Angelini1, F. Mingolla1, P. Natale2 and F.Faretra1. 1Dipartimento di Protezione delle Piante e MicrobiologiaApplicata, Università degli Studi, Via Amendola 165/A, 70126Bari, Italy. 2Centro di Ricerca e Sperimentazione in Agricoltura“Basile Caramia”,Via Cisternino 281, 70010 Locorotondo (BA),Italy. E-mail: [email protected]

Ocratoxin A (OTA) is a common contaminant of severalfoods and beverages. Aspergillus carbonarius (Bainier) Thom isthe main responsible of OTA contamination of grapes and winesin the Mediterranean area. Although fungicides (i.e. anylinopy-rimidines) are available for controlling this fungus, IPM strategiesare essential to limit contamination below the maximum tolerablelimit of 2.0 µg kg-1 of OTA established for wine and other grape-juice derivatives [Reg. (CE) N. 123/2005 of 26.1.2005]. Investiga-tions carried out in southern Italy showed that several factors, i.e.grape cultivars and clones, growing areas, training systems, fungaldiseases and pests, influence the risk of contamination. ‘Gagliop-po’, ‘Negroamaro’, ‘Primitivo’ and ‘Sangiovese’ were more sus-ceptible than ‘Cabernet sauvignon’ to contamination. Withineach cultivar, the risk of contamination differs with the clone, be-ing higher for clones with compact bunches and thin-skin berries(i.e. ‘Primitivo’ 36C, 9.1 ng OTA g-1 must) than clones with lesscompact bunches and thick-skin berries (i.e. ‘Primitivo’ 35I, 0.1ng OTA g-1 must). Vineyards near the sea were generally at high-er risk of OTA contamination than those in windy areas. Similar-ly, trellis- and arbor trained vineyards were at higher risk than thehead-pruned (alberello pugliese) plantings. The level of contami-nation of musts by A. carbonarius and OTA was correlated(r2=0.5-0.9) with the severity of damage to the bunches causedby fungal diseases (esca and powdery mildew) or pests (Lobesiabotrana). Such findings indicate that a careful integrated manage-ment of cultural practices and crop protection of vineyards is es-sential for reducing the risk of OTA contamination.

CRITICAL POINTS FOR PHAEOMONIELLA CHLAMY-DOSPORA INFECTIONS OF PROPAGATION MATERIALSIN GRAPEVINE NURSERIES. S. Pollastro, A. Pichierri, W.Habib, N. Masiello, C. Sebaaly and F. Faretra. Dipartimento diProtezione delle Piante e Microbiologia Applicata, Università degliStudi, Via Amendola 165/A, 70126 Bari, Italy. E-mail: faretra@ agr.uniba.it

Phaeomoniella chlamydospora (Gams, Crous, Wingf. et Mug-nai) Crous et Gams, a fungus involved in brown streaking ofrootstocks, Petri disease and esca disease of grapevine, is fre-quently detected in rootstocks ready to be planted. Hence, infect-ed propagation material is supposed be its main cause for dissem-ination to new vineyards. Nested-PCR was used to detected P.chlamydospora in 374 grafts and cuttings before callusing, 373graft-cuttings after callusing, 319 grafted rootstocks, 248 watersamples from 80 tanks used for pre-grafting or pre-callusing hy-dration and 155 samples of plant debris from blades and benchesof 40 grafting machines, collected in several nurseries in southernItaly. For plant materials, the type and severity of wood discol-oration was assessed using an empirical scale with six classes. Anincrease in the frequency of pathogen detection was observedduring the various stages of the process: P. chlamydospora was notdetected in grafts and dormant cuttings, it was found in 7% ofthe graft-cuttings, and in 57% of grafted rootstocks. A similartrend was observed for wood discoloration which reached aMcKinney’s Index as high as 48% in grafted rootstocks. P.chlamydospora was detected in water samples collected from 30%of the tanks and in debris samples collected from 23% of graftingmachines in all the nurseries. Such findings point out several crit-ical points in the production of grapevine propagation materialsthat should be kept under control for preventing infections andthe consequent spreading of the fungus in new vineyards.

SCREENING OF FRESH MARKET TOMATO FOR RESIS-TANCE TO PYRENOCHAETA LYCOPERSICI. N. Pucci1, S.Voltattorni2, A. Infantino1 and N. Acciarri2. 1CRA, Istituto Spe-rimentale per la Patologia Vegetale, Via C.G. Bertero 22, 00156Roma, Italy. 2CRA, Istituto Sperimentale per l’Orticoltura, Via Sala-ria 1, 63030 Monsampolo del Tronto (AP), Italy. E-mail: [email protected]

Pyrenochaeta lycopersici is a soil-borne fungus causal agent of“corky root” of tomato (Solanum lycopersici L.) that has ham-pered the cultivation of several tomato ecotypes/varieties lackingthe resistance gene py-1. The aim of the present work was thetransfer of genetic resistance to P. lycopersici from resistant cvs.Moboglan and Mogeor in Cuore di Bue di Albenga, a traditionalItalian cultivar, within the framework of the national projectPROM (Progetto di Ricerca per potenziare la competitività diOrticole in aree Meridionali). One isolate of the CRA-ISPaVecollection (ISPaVe ER-1211), out of 20 screened, was choosenfollowing artificial inoculation on the susceptible tomato cv.Monalbo and the resistant tomato cv. Moboglan. A total of 19tomato breeding lines (two F2; ten F3; five F4 and two F2BC1)segregating for py-1 were screened in the greenhouse by growingtomato seedling (36 plants for each line) into a soil artificially in-fested with the fungus. Disease evaluation was done after 40 daysusing a 0-4 empirical scale based on the percentage of necrotizedroots. As a result, 6 lines were considered resistant, 4 susceptibleand 9 intermediate. In order to validate the efficiency of the mo-lecular marker for py-1, apical leaves of each plant were used forDNA extraction and PCR amplification. Preliminary resultsshowed a positive correlation between disease scoring and mark-er profiling. If confirmed on the other lines tested, this marker



will be used in marker-assisted selection procedures, allowing therapid large-scale screening of tomato lines for corky root resist-ance.

Research supported by The Ministry of Agricultural Alimenta-ry and Forest Politics with funds released by C.I.P.E. (Resolution17/2003).

CHARACTERIZATION OF LIPOXYGENASE GENES ANDOXYLIPIN PROFILE IN ASPERGILLUS OCHRACEUS. F.Punelli1, M. Reverberi1, H. Velez3, M. Scarpari1, S. Zjalic1, A.Ricelli2, A. Dobson3, C. Fanelli1 and A.A. Fabbri1. 1Dipartimentodi Biologia Vegetale, Università “La Sapienza”, Largo Cristina diSvezia 24, 00165 Roma, Italy. 2Istituto di Scienze delle ProduzioniAlimentari del CNR, Via Amendola 122/O, 70126 Bari, Italy. 3Mi-crobiology Departement, University College, College Road, Cork,Ireland. E-mail: [email protected]

In previous works the lipoxygenase (lox) profile of Aspergillusochraceus (wt, OTA producer), was characterized. A lox fragmentof 673 bp - DQ087531 (47-78% homology with other fungallipoxygenase sequences), was found and studied. This fragmentwas used to generate a Dlox mutant which showed delayed coni-dia formation and increase of sclerotia production. In addition,low lipoperoxide formation in the mycelium, reduced lipoxyge-nase activity and strong reduction of OTA biosynthesis were ob-served in the mutant in comparison with wt. The use of lipoxyge-nase inhibitors (SHAM, salicylhydroxamic acid and resveratrol)allowed to further study the role played by lipoperoxides alter-ation in OTA synthesis by A. ochraceus. Resveratrol showed an-tioxidant properties and inhibition effect on lipoxygenase and ci-cloxygenase in humans. In A. ochraceus wt the use of this LOX-inhibitors led to a delay of lipoxygenase activity and oxylipin pro-file in comparison with Dlox showing a marked reduction oflipoperoxides and OTA formation. Supplementation of culturemedia with several fatty acids was also investigated. The completelox gene sequence was obtained with several techniques such asGenome Walker Library, Reverse PCR and 5'-3' RACE. In con-clusion, the results obtained with both wt and Dlox indicate thatlipoperoxidation plays a major role in controlling OTA biosyn-thesis in A. ochraceus.

FIRST INSIGHT ON THE POSSIBLE CORRELATION BE-TWEEN BACTERIOLYTIC ACTIVITY AND BIOFILM FOR-MATION IN A LYSOBACTER sp. STRAIN. G. Puopolo1, A.Raio2 and A. Zoina1. 1Dipartimento di Arboricoltura, Botanica ePatologia Vegetale, Sezione di Patologia Vegetale, Università degliStudi di Napoli “Federico II”, Via Università 100, 80055 Portici(NA), Italy. 2Istituto per la Protezione delle Piante del CNR, ViaUniversità 133, 80055 Portici (NA), Italy. E-mail: [email protected]

Most members of the genus Lysobacter possess high bacterioli-tyc activity against both Gram-negative and Gram-positive bacte-ria. Lysobacter sp. strain PG4 was evaluated on different growthmedia for its antagonistic activity towards 16 strains belonging todifferent bacterial species. The highest bacteriolytic activity wasobserved against bacterial species belonging to the Gram-positivegroup such as Clavibacter michiganensis subsp. michiganensis,Rhodococcus fascians and Listeria monocytogenes while no activitywas scored against Gram-negative bacteria. The bacteriolytic ac-tivity was affected by growth media. King’s B Medium (KBM)was the only one that affected negatively the antibiotic capacity ofstrain PG4. Interestingly, the addition of FeCl3 to this medium

restored PG4 bacteriolytic activity indicating that Fe3+ ions areinvolved in this activity. Some of the growth media used in bacte-riolytic tests were also used in adhesion assays performed in 96wells polystyrene plates, a common test that allows to evaluatethe production of biofilm by bacteria. The ability of Lysobactersp. strain PG4 to form biofilm was correlated to the entry in thestationary phase, except when the bacterium was cultivated inKBM. By contrast, strain PG4 was unable to form biofilm at all.These results represent a first insight on the correlation betweenbiofilm formation and bacteriolytic activity in a member of thegenus Lysobacter.

TOBACCO-ERYSIPHE CICHORACEARUM: A POSSIBLE ROLEOF PLANT SEMIOCHEMICALS IN INDUCED RESISTANCE.M. Quaglia, C. Zadra, M. Fabrizi, D. Volpe and A. Zazzerini. Di-partimento di Scienze Agrarie e Ambientali, Università degli Studi,Borgo XX Giugno 74, 06121 Perugia, Italy. E-mail: quagliamara@ hotmail.com

Plants release a large number of volatile molecules (includingethylene, terpenoids, lipoxygenase-derived volatiles) and theemission profiles change after damaging. Several studies havedemonstrated that semiochemicals play an important role in plantdefence against biotic stresses, for example, some plants may emitmolecules when attacked by herbivores to attract their natural en-emies. Moreover, exogenous application of these molecules caninduce a subset of defence responses against fungal and bacterialpathogens. In order to evaluate the role of semiochemicals in to-bacco (Nicotiana tabacum cv Havana 425) resistance againstErysiphe cichoracearum (causal agent of powdery mildew), analy-ses were conducted to identify and quantify the emission ofvolatile compounds in uninfected and infected plants. Plantswere analysed at different time intervals after infection done byspraying an aqueous suspension containing 105 fresh conidia/ml.Volatile compounds emitted from plants were collected by head-space-solid phase micro extraction (HS-SPME) and analysed bygas chromatography (GC-FID) and gas chromatography–massspectrometry (GC-MS). Significant differences in the emission ofvolatile compounds by infected plants were observed with timewith respect to uninfected control. An increase in terpenoids (E-b-ocimene and Z-b-ocimene) was observed 24h after infection,whereas cis-jasmone and methyl-jasmonate showed highest con-centrations at 48 and 72h after infection, respectively. The volatilecompounds reported above will be further tested for their abilityto induce resistance in tobacco against powdery mildew.

AETIOLOGY OF BARK CANKERS ON TIMBER JUGLANSTREES: FURTHER RESULTS. F. Ravaioli, A. Fabi, L. Varvaroand N. Anselmi. Dipartimento di Protezione delle Piante, Univer-sità degli Studi della Tuscia, Via S. Camillo de Lellis, 01100 Viter-bo, Italy. E-mail [email protected]

Bark canker is one of the most noxious diseases of walnuttrees (Juglans regia) for timber production as it causes seriouswood deterioration. During the last years several studies havebeen carried out in Italy to determine the etiology of the disease.Isolations from wood at the border of the lesions showed thepresence of five pathogens, i.e. the bacterium Brenneria nigriflu-ens and the fungi Botryosphaeria sp., Fusarium solani, Para-phaeosphaeria sp., and Phomopsis sp. Fungi were identified mor-phologically and B. nigrifluens molecularly and by atty acid pro-filing. Paraphaeosphaeria and Phomopsis were occasionally pres-ent in the lesions while Botryosphaeria and F. solani were always



associated with cankers. Artificial inoculations made on youngscions of J. regia, J. nigra and their hybrid NG23 with the abovementioned three main pathogens always produced necrosis, witha maximum colonizing speed for Botryosphaeria sp., followed byB. nigrifluens and F. solani. These tests have shown that J. regiaproved more susceptible than J, nigra whereas the hybrid NG23had an intermediate behaviour.

NEW DIAPORTHE/PHOMOPSIS SPECIES ON SOYBEAN. L.Riccioni1 and K. Vrandecic2. 1CRA, Istituto Sperimentale per laPatologia Vegetale, Via C.G. Bertero 22, 00156 Roma, Italy. 2Fac-ulty of Agriculture, University of J.J. Strossmayer, P.O. Box 71,31000 Osijek, Croatia. E-mail: [email protected].

Diaporthe/Phomopsis (D/P) isolates obtained from thirty seedsamples of soybean were grouped by PCR-RFLP method andmorphological characteristics in three groups. Two group withuniform RFLP-PCR profile included Phomopsis longicolla andDiaporthe phaseolorum var. caulivora isolates; respectively, where-as the third group, characterized by 5 different RFLP-PCR pro-files and by producing alfa and beta conidia, included isolatespreviously identified as D. phaseolorum var. soyae. To clarify thedubious identification of the isolates of the third group, the ITSrDNA regions of 29 representative isolates were sequenced. Aphylogenetic analysis of ITS data distinguished four well support-ed clades. Based on this study, only 50% of the isolates can beidentified as D. phaseolorum var. soyae, all other isolates belong toa putative new D/P species on soybean.

ACCUMULATION OF CITRUS VIROID III IN THREE DIF-FERENT ROOTSTOCKS AND EXPRESSION OF SOMEGENES. S. Rizza1, G. Catara3, C. Capasso3, V. De Luca3, G. No-bile2, V. Carginale3 and A. Catara1,2. Dipartimento di Scienze eTecnologie Fitosanitarie, Università degli Studi, Via S. Sofia 100,95123 Catania, Italy. 2Parco Scientifico e Tecnologico della Sicilia,Zona Industriale, Stradale G. Agnelli angolo V. Lancia, 95030Catania, Italy. 3Istituto di Biochimica delle Proteine del CNR, ViaP. Castellino 111, 80131 Napoli, Italy. E-mail: [email protected]

Gene expression in symptomless sour orange, Troyer citrangeand alemow seedlings inoculated with a Citrus viroid III (CVd-II-Ib) source was compared with Etrog citron showing the typicalsymptoms induced by the viroid. To detect the viroid infectionsignal in inoculated seedlings, green bark samples were processedthrough a rapid and sensitive RT-SYBR Green I-based real timePCR assay for CVd-III quantification. A proper signal was de-tected ten weeks after inoculation in the three rootstocks withoutsignificant differences in viroid titre among them. Among the up-and down-regulated genes previously identified by DDRT-PCR inEtrog citron following CVd-IIIb infection, metallothionein (MT),alcohol-dehydrogenase (ADH), ethylene-responsive binding pro-tein (EREBP), regulator of gene silencing (RGS), aminoacid per-mease (AP), peroxidase (PRX), and CONSTANS-like proteinwere chosen to verify if their expression pattern was different inother citrus species. Northern blot analysis showed that Etrog cit-ron, Troyer citrange, sour orange and alemow exhibited the sameexpression pattern for almost all the genes following CVd-III in-fection. However, AP expression levels did not vary in Troyer cit-range, and PRX was down regulated in alemow.

BIOLOGICAL AND MOLECULAR CHARACTERIZATION OFTWO ADDITIONAL CITRUS TRISTEZA VIRUS ISOLATESASSOCIATED WITH SOUR ORANGE INVERSE PITTING. S.Rizza1, A. Lombardo2, G. Nobile2 and A. Catara1,2. 1Dipartimen-to di Scienze e Tecnologie Fitosanitarie, Università degli Studi diCatania, Via S. Sofia 100, 95123, Catania, Italy. 2Parco Scientifico eTecnologico della Sicilia, Stradale G. Agnelli angolo V. Lancia,95030 Catania, Italy. E-mail: [email protected]

In recent years, Citrus tristeza virus (CTV) has often been re-ported in Italy as detected by DAS-ELISA and immunoprinting,but information on the biological, molecular and pathogenicproperties of the different isolates is still limited. In 2005, during acitrus orchard survey in the province of Catania (Sicily), some cv.Sanguinello sweet orange trees in a 30-year-old grove showedslight but clear inverse pitting on sour orange rootstock. Since thiswas the first report of symptoms of CTV on sour orange rootstockin Italy, a study was undertaken to characterize the isolate of CTVinfecting two representative trees of the orchard through ELISA,indexing on indicator plants, and nucleotide sequence analysis.Mexican lime seedlings inoculated by leaf punch showed typicalvein clearing after only ten days, whereas sour orange, sweet or-ange and grapefruit seedling bark inoculated with two sanguinellosources showed different degrees of stunting, yellowing, smalland/or cupped leaves and vein corking. The gene coding for p23was amplified and the nucleotide sequences were determined inboth directions. BLAST analysis showed a nucleotide identity of99% with seedling yellow strains like BaraoB, Val-CB and C271-2.Since it is clear that the isolates were different from those previ-ously reported in spite of the proximity of the grove to that inves-tigated by others, we assume that more than an introduction ofCTV has occurred in recent years in Sicily.

SOFT ROGUING INDUCES RECOVERY IN BOIS NOIR IN-FECTED GRAPEVINES. G. Romanazzi1, S. Murolo1, L. Landi1and S. Virgili2. 1Dipartimento di Scienze Ambientali e delle Pro-duzioni Vegetali, Università Politecnica delle Marche, Via BrecceBianche 10, 60131 Ancona, Italy. 2Agenzia Servizi Settore Agroali-mentare delle Marche, Via Alpi 21, 60131 Ancona, Italy. E-mail:[email protected]

Bois Noir (BN), the main grapevine yellows in Central Italy,has been spreading through several European countries over thelast years. This disease, caused by “Candidatus Phytoplasmasolani”, can result in severe crop losses and death of the vines. Atpresent, there are no known effective control methods for con-trolling BN or other phytoplasmas. Roguing and transplanting ofthe vines infected by phytoplasmas can induce the phenomenonknown as “recovery”, whereby disease symptoms disappear fromthe canopy. In the Marche region, at the beginning of spring2006, grapevines infected by BN were exposed to soft roguing,obtained by disrupting part of the root system using a small exca-vator. Plants of cvs Chardonnay, Sangiovese, and Verdicchio,grafted on Kober 5BB and trained as low cordon, were partiallyrogued and left in their position. Soft rouging induced recoveryin all 5 plants of cvs Chardonnay and Verdicchio and in 4 out of 5of cv. Sangiovese. The same experiment, carried out ongrapevines of cv. Chardonnay grafted on 420A and trained ashigh cordon (single curtain), proved to be less effective. Suchpreliminary results show possible interactions between the typeof rootstock and/or the training system and the effectiveness ofsoft roguing in the induction of recovery in BN-infected vines.An increased expression of the phenylalanine ammonia-lyasegene was observed in recovered plants.



ORGANIC PLANT PROTECTION STRATEGIES AGAINSTBACTERIAL PATHOGENS OF KIWIFRUIT. A. Rossetti1, A.Quattrucci1, L. Fratarcangeli1, M. Benuzzi2, G.M. Balestra1. 1Di-partimento di Protezione delle Piante, Università degli Studi dellaTuscia, Via S. Camillo de Lellis, 01100 Viterbo, Italy. 2IntrachemBio Italia S.p.A., Via Calcinaro 2085/7, 47023 Cesena (FO), Italy.E-mail: [email protected]

During the last 15 years, in Italy and in other kiwifruit-grow-ing areas of the world frequent attacks by Pseudomonas syringaepv. syringae (Pss) and Pseudomonas viridiflava (Pv) have beenrecorded. Pss and Pv populations resulted able to survive on aeri-al kiwifruit organs during the different seasons. Both pathogensinduce heavy damage to the foliage and reduce the yield. More-over, by their ice nucleation activity (INA), they result particular-ly dangerous to cause/favour frost damages to different organs.Control of Pss and Pv largely depends on treatments with coppercompounds, their frequency and timing of application. Recently,different attempts have been made to improve the level of protec-tion of kiwifruit plantings from both micro-organisms. To reducethe environmental impact of copper, especially in organic ki-wifruit stands, studies were carried out to optimize its utilisationand to evaluate the use and efficacy of natural antagonists.

DYNAMICS OF THE PRIMARY INOCULUM OF VENTURIAPIRINA, THE CAUSAL AGENT OF PEAR SCAB. V. Rossi1, E.Pattori1, F. Salinari1, R. Bugiani2 and S. Giosuè1. 1Istituto di En-tomologia e Patologia Vegetale, Università Cattolica del SacroCuore, Via Emilia Parmense 84, 29100 Piacenza, Italy. 2Servizio Fi-tosanitario Regionale, Via di Saliceto 81, 40128 Bologna, Italy. E-mail: [email protected]

A 5-year study was carried out in two pear orchards of northernItaly, by trapping ascospores of Venturia pirina with volumetricspore samplers operated continuously during the ascospore season,with the aim of better defining weather conditions favouring as-cospore discharge. Characteristic of ascospore discharge and con-ditions of temperature, rainfall and leaf wetness were observedduring each event, in order to discriminate between weather condi-tions favouring or not ascospore release. Differences in the lengthof the trapping season (from 32 to 75 days) and number of as-cospores trapped (from a minimum of 135 to a maximum of 3833spores m3 air/season) were observed. Ascospores of V. pirinashowed a diurnal periodicity similarly to those of V. inaequalis, asmost of them (92%) were trapped between 6 am and 8 pm. In ag-gregate 185 ascospore discharge events were observed. Rainfalltriggered 37% of trapping events and accounted for the highestpercentage of trapped spores (44%). Trappings associated withwet periods without rain were 55%, while 8% occurred in dryconditions. A method to estimate the dynamic of the primary in-oculum was elaborated using a logistic equation to estimate the on-set of the ascospore season, and an asymptotic model to estimatethe subsequent dynamics of primary inoculum. This method yield-ed satisfactory results showing a significant correlation betweenobserved and estimated data (r=0.90) and proved able to forecastboth early and late ascospore releases.

EFFECT OF CRYPHONECTRIA PARASITICA VIRUS 1 INFEC-TION IN CRYPHONECTRIA PARASITICA ISOLATES FROMPIEDMONT. L. Rostagno1, G. Crivelli1, M. Turina1 and G. Tami-etti2. 1Istituto di Virologia Vegetale del CNR, Strada delle Cacce 73,10135 Torino, Italy. 2Dipartimento di Valorizzazione e Protezionedelle Risorse Agroforestali, Università degli Studi di Torino, Via Leo-

nardo da Vinci 44, 10095 Grugliasco (TO), Italy. E-mail: l.rostagno @ivv.cnr.it

Cryphonectria parasitica is the etiological agent of chestnutblight, a fungal disease endemic in Northern Italy. A collection ofC. parasitica isolates from Pellice, Gesso, Tanaro and Mala valleysin Piedmont was evaluated for the presence or absence of dsRNAand, in particular, for the presence of Cryphonectria hypovirus 1(CHV-1), a virus known to cause hypovirulence when present inthe cytoplasm of its fungal host. Five isolates carrying CHV-1 intheir cytoplasm, and showing phenotypic variability when cul-tured on PDAmb plates, were single-spored. Virus-free isogenicisolates were obtained from each CHV-1 infected isolate throughscreening of conidial progeny. The effect of the virus on fungalvirulence was evaluated through inoculation of 3-year-old Euro-pean chestnuts (Castanea sativa). Surprisingly, when measuringcanker area of virus-infected and isogenic virus-free C. parasiticaisolates, no statistically significant advantage due to the presenceof CHV-1 was observed in some of the fungal isolates studied.We are currently evaluating the molecular diversity of the CHV-1and C. parasitica isolates object of our investigation. Furthermore,we report on the phenotype of C. parasitica strains over-express-ing Cpkk1, a MAPKK isolated from C. parasitica, previouslyshown to be infected by CHV-1

PRODUCTION OF ENNIATINS BY FUSARIUM TRICINC-TUM AND THEIR EFFECTS ON DIPLODIA CORTICOLA. A.Ruscelli1, G. Campanile1, A. Moretti2, S. Somma2, A. Ritieni3and N. Luisi1. 1Dipartimento di Biologia e Patologia Vegetale, Uni-versità degli Studi, Via Amendola 165/A, 70126 Bari, Italy. 2Istitu-to di Scienze delle Produzioni Alimentari del CNR, Via Amendola122/O, 70126 Bari, Italy. 3Dipartimento di Scienze degli Alimenti.Università degli Studi di Napoli “Federico II”, Via Università 100,80055 Portici (NA), Italy. E-mail: [email protected]

Diplodia corticola A.J.L. Phillips, Alves & Luque is the causalagent of cankers, vascular necrosis and dieback in various oakspecies. Scanty information is available on the biological controlof this fungus. However, in a recent study, a strain of Fusariumtricinctum (Corda) Sacc., isolated from the buds of Quercus pubes-cens Willd. in declined oak woods, showed maximum inhibitionof D. corticola growth both in vitro and in planta. The F. tricinctumstrain has been evaluated for its capability to produce possibletoxic metabolites toward D. corticola. Fungal extracts from an invitro rice kernel culture of F. tricinctum were analyzed by HighPerformance Liquid Chromatography (HPLC), showing that thisstrain was able to produce high levels of enniatin B, enniatin B1,enniatin A1 and enniatin A (5050 µg/g; 4750 µg/g; 1860 µg/g, and240 µg/g, respectively). These metabolites were inoculated inseedlings of Q. cerris L. and Q. pubescens to investigate possiblephytotoxic properties and their ability to reduce the growth of D.corticola was evaluated with in vitro tests. The results obtainedshowed that the enniatins produced by F. tricinctum were biologi-cally active towards D. corticola and were not phytotoxic to theseedlings. The potential use of these metabolites for the biologicalcontrol of D. corticola on oaks deserves further study.

EVALUATION OF A QUANTITATIVE REAL-TIME PCR AS-SAY TO MONITOR PHOMA TRACHEIPHILA COLONIZA-TION IN DIFFERENT CITRUS HOSTS. M. Russo1, F. Grasso1,G. Licciardello1,2 and V. Catara1. 1Dipartimento di Scienze e Tec-nologie Fitosanitarie, Università degli Studi, Via S. Sofia 100,95123 Catania, Italy. 2Parco Scientifico e Tecnologico della Sicilia,



Zona Industriale, Stradale G. Agnelli angolo V. Lancia, 95030Catania, Italy. E-mail: [email protected]

Seedlings of lemon (‘Femminello’, and ‘Lunario’), Mexicanlime, ‘Hamlin’ sweet orange, Troyer citrange, Poncirus trifoliataand sour orange were inoculated with Phoma tracheiphila phialo-conidia to evaluate colonization rates in relation to symptom de-velopment. Moreover, fungal survival in soil inoculated withphialoconidia was also evaluated. P. tracheiphila DNA was quan-tified by a real-time PCR assay previously developed with slightmodification to the Taq-Man probe labeling. Seedlings of theabove-mentioned species were inoculated in the leaves with a wa-ter suspension containing 106 phialoconidia ml-1. Disease devel-opment was monitored weekly using an arbitrary scale based onthe intensity of leaf symptoms. Fourteen days after inoculation,leaf disks were removed from the inoculation points with a corkborer and DNA was recovered with a commercial DNA extrac-tion kit. P. tracheiphila was quantified by real-time PCR assay inthe leaf disks. Threshold cycle values from the assay with un-known samples were plotted against the standard curve and theinferred concentration of the fungus were calculated. FungalDNA was also detected in the leaves of the citrus species that hadnot yet developed symptoms. The method was also applied suc-cessfully to soil samples.

EVALUATION OF FIVE FLUORESCENT PSEUDOMONADSFOR THE PREVENTION OF TOMATO CROWN ROOT ROTAND TOMATO WILT DISEASE CAUSED BY FUSARIUMOXYSPORUM f. sp. RADICIS LYCOPERSICI AND FUSARIUMOXYSPORUM f. sp. LYCOPERSICI. A. Russo1, G. Puopolo1, A.Raio2 and A. Zoina1. 1Dipartimento di Arboricoltura, Botanica e Pa-tologia Vegetale, Sezione di Patologia Vegetale Università degli Studidi Napoli “Federico II”, Via Università 100, 80055 Portici (NA),Italy. 2Istituto per la Protezione delle Piante del CNR, Via Univer-sità, 133, 80055 Portici (NA), Italy. E-mail: [email protected]

Fusarium oxysporum f. sp. radicis lycopersici and Fusarium oxys-porum f. sp. lycopersici represent a high threat for tomato crops.Banning of methyl bromide fumigation associated with the in-creasing demand for safer crop production led to consider newmanagement strategies for the control of these two phytopatho-genic fungi. One of these strategies relies on the selection and ex-ploitation of antagonistic bacteria able to protect the plantsagainst these fungal pathogens. The genus Pseudomonas repre-sents a reservoir of potential antagonistic agents against severalphytopathogenic Fusarium species. In this work, five fluorescentpseudomonad strains were characterized for their antagonistic at-titudes by scoring siderophore, protease and antibiotic productionand by evaluating the inhibition of mycelial growth of both Fusari-um species in vitro. Moreover the production of quorum sensingsignals by Pseudomonas strains was assessed by using the twobiosensor strains Chromobacterium violaceum CV026 and Agro-bacterium tumefaciens NTL4. Finally the five strains were evaluat-ed for the control of both phytopathogenic fungi on tomatoplantlets with an useful and predictive in vivo approach. Resultsshowed that P. chlororaphis strain M71 was the only pseudomonadable to produce siderophores, proteases, antibiotics and quorumsensing signals. Furthermore, this bacterial strain resulted to besignificantly effective in the reduction of disease gravity in bothcases while the other pseudomonad strains, belonging to P. fluo-rescens group failed to protect tomato plantlets.

EVALUATION OF LATE BLIGHT RESISTANCE IN POTATOBREEDING CLONES SUITABLE FOR ORGANIC FARMING.E. Sala, P. L. Burzi, S. Galletti, S. Marinello and C. Cerato. CRA,Istituto Sperimentale per le Colture Industriali, Via di Corticella133, 40129 Bologna, Italy. E-mail: [email protected]

Phytophthora infestans causes late blight on a range of solana-ceous plant species. The most frequently used management strat-egy against this disease relies on repeated fungicide applicationsand use of partially resistant cultivars. Eighteen new Italianbreeding clones of potato were evaluated for their resistance tolate blight under controlled and field conditions in absence ofchemical treatments. Foliage resistance tests were conducted in-oculating 60-day-old potato plants with a P. infestans isolate phe-notipically characterized for mating type (A1) and avirulencegenes (R1, R2, R3, R4, R6, R7, R8, R 10, R11). The pathogen iso-late was also used to inoculate tubers of the same clones follow-ing the shallow wounds method. One clone showed high resist-ance to foliage late blight while other two clones showed veryhigh resistance on tuber assay. Field trials were carried out in2006 and 2007 under natural inoculum pressure in Sicily. In2006, pathogen pressure was very low, preventing the detectionof significant differences among the clones. On the contrary in2007, under high pathogen inoculum pressure, one clone thathad shown good resistance levels in greenhouse tests was foundvery tolerant. Our results did not show significant correlation be-tween tuber and foliage resistance of the same genotype as re-ported in the literature. Moreover, these results suggest that pre-liminary greenhouse screenings could partially predict field resist-ance levels helping breeder’s work.

MOLECULAR ANALYSIS OF PHLOMIS MOTTLE VIRUS. P.Saldarelli, D. Boscia and C. Vovlas. Dipartimento di Protezionedelle Piante e Microbiologia Applicata Università degli Studi andIstituto di Virologia Vegetale del CNR, Sezione di Bari, Via Amen-dola 165/A, 70126 Bari, Italy. E-mail: [email protected]

A virus provisionally called Phlomis mottle virus (PhMV), iso-lated in 2006 from Phlomis fructicosa (family Lamiacee) by me-chanical transmission to Nicotiana occidentalis, has flexuous par-ticles 800-850 nm long, with an outward aspect recalling those ofsome members of the family Flexiviridae. Sequencing of a 363 ntfragment of the RNA dependent RNA polymerase (RdRp) genehad disclosed homology with the comparable protein of Bananavirus X (BanVX), an unassigned member to the family Flexiviri-dae. Further sequencing of a 3035 nt fragment of the viralgenome, spanning from the RdRp gene to the 3' terminal poly(A)tract, has now shown a structural organization comparable to thatof species of the genus Trichovirus. The 5' proximal open readingframe (ORF1) encoding the RdRp protein, is followed by twoORFs showing homologies with movement proteins of the p30superfamily (ORF2) and the coat proteins of flexivirids (ORF3).The expression products of all three ORFs have a substantial lev-el of identity with the corresponding proteins of members of thegenus Trichovirus, a result confirmed by phylogenetic analysis. Afurther 3’most ORF, encoding a RNA binding protein, was iden-tified which, as in the case of some trichoviruses, lacks the canon-ical AUG initiation codon. The molecular analysis of the PhMVgenome, though incomplete, strongly suggests that this virus is amember of the genus Trichovirus.



CHARACTERIZATION OF FUSARIUM LANGSETHIAE ISO-LATED FROM WHEAT KERNELS IN ITALY. A. Santori1, G.Aureli2, M.G. D’Egidio2 and A. Infantino1. 1CRA, Istituto Speri-mentale per la Patologia Vegetale, Via C.G. Bertero 22, 00156 Ro-ma, Italy. 2CRA, Istituto Sperimentale per la Cerealicoltura, ViaCassia 176, 00101 Roma, Italy. E-mail:[email protected]

Among seed-borne fungi present on wheat kernels (Triticumdurum Desf. and T. aestivum L.), several Fusarium species are ofinterest due to their ability to produce mycotoxins. Fusariumlangsethiae, a species producing type A trichotecenes (T2 andHT2 toxins) harmful to humans and cattle, has been recently iso-lated from durum and common wheat kernels coltivated in cen-tral and southern Italy. Toxin production of seven F. langsethiaeisolates grown on autoclaved wheat kernels was measured withthe ELISA Ridascreen T2 kit (Biopharm, Glasgow, UK). Someisolates were positive for T2 production. The pathogenicity ofone isolate (ISPaVe ER-1409) was evaluated in the open field byspraying plants of cv. Simeto at the 10.5.2 Feeke’s scale growthstage with a suspension of 1×105 spores ml-1 of the fungus. F.graminearum (ITEM 1852) and F. culmorum (ITEM 1851) wereinoculated at the same concentration of F. langsethiae for symp-tom comparison. Controls were sprayed only with water. Foreach species, 0.8 m2 plots with three replicate were inoculated.To maintain high humidity levels, plants within each plot werecovered with plastic bags for 48 h. Typical Fusarium head blightsymptoms developed after 15 days only on spikes inoculated withF. graminearum and F. culmorum with a McKinney severity of87.2 and 89.8, respectively while no differences with the controlwere observed on plants inoculated with F. langsethiae. Epidemi-ological studies are in progress to assess the distribution and theincidence of this fungus in Italy.

IDENTIFICATION OF APPLE GENES DIFFERENTIALLY EX-PRESSED IN RESPONSE TO QUERCETIN APPLICATION.S.M. Sanzani1, L. Schena2, A. De Girolamo3, A. Ippolito1 and L.Gonzalez Candelas4. 1Dipartimento di Protezione delle Piante eMicrobiologia Applicata, Università degli Studi, Via Amendola165/A, 70126, Bari, Italy. 2Dipartimento di Gestione dei SistemiAgrari e Forestali, Università Mediterranea, Località Feo di Vito,89060 Reggio Calabria, Italy. 3Istituto di Scienze delle ProduzioniAlimentari del CNR, Via Amendola 122/O, 70126 Bari, Italy. 4Insti-tuto de Agroquimica y Tecnologia de Alimentos (IATA), Consejo Su-perior de Investigaciones Científicas, Apartado 73, 46100 Burjassot,Valencia, Spain. E-mail: [email protected]

Penicillium expansum Link infections of apples result in eco-nomic losses in all producing countries and have potential publichealth significance, since may cause accumulation of the myco-toxin patulin. Control of this postharvest pathogen is commonlydone with fungicides; however the appearance of resistant strainsand consumer concern about food and environmental safety areleading to an increasing demand for alternative treatments. Inprevious trials the phytoalexin quercetin was effective in reducingboth disease severity and toxin accumulation. Since quercetinwas more effective in in vivo than in in vitro trials, it was believedto enhance host resistance. To verify this hypothesis the method“Suppression Subtractive Hybridization” (SSH), was used to construct a library of cDNA differentially expressed afterquercetin application. A set of cDNA clones was obtained, out ofwhich 150 were randomly selected, analysed for the presence of asingle insert and sequenced. Most sequences revealed high simi-larities with those available in GenBank databases. In particular,a correspondence was obtained with different classes of patho-genesis-related proteins, such as RNase-like PR10 and PR8 pro-

tein, and with proteins expressed under stress conditions. In ad-dition, several transcripts showed similarity to genes coding pro-teins having a role in host-pathogen recognition and in signallingpathways. Similarity was also found with genes coding for pro-teins whose role in defence mechanisms is still unknown. Furtherstudies are in progress to quantify accurately the expression ofthese genes and to correlate them with the Penicillium control ex-erted by quercetin application to apples.

REAL-TIME RT-PCR ASSAY FOR DETECTION AND DIFFER-ENTIATION OF CITRUS TRISTEZA VIRUS ISOLATES. M.Saponari1 and R. K. Yokomi2. 1Istituto di Virologia Vegetale delCNR, Sezione di Bari e Dipartimento di Protezione delle Piante eMicrobiologia Applicata, Università degli Studi, Via Amendo-la, 165/A, 70126 Bari, Italy. 2USDA, ARS, San Joaquin ValleyAgricultural Sciences Center, Parlier, CA 93648, USA. E-mail:[email protected]

For universal detection of Citrus tristeza virus (CTV) strainsby real time RT-PCR, a protocol was developed based on a set ofprimers and a Cy5-labeled TaqMan probe. This test includedprimers and a TET-labeled TaqMan probe selected on the mito-chondrial nad5 gene for the simultaneous detection of RNA as aninternal control. This protocol was tested on total RNA extractsfrom fresh, frozen, and desiccated leaf petioles from CTV-infect-ed plants with 80 isolates from a worldwide collection of CTVisolates maintained in planta in Beltsville, MD and Tulare andParlier, CA, USA. A dilution series of an in vitro synthesized tran-script containing the target sequence showed that the protocoldetected less than 2 fg of viral template. A multiplex, one-step re-al-time RT-PCR assay was also developed for the detection anddifferentiation of CTV strains. Based on multiple alignments ofthe nucleotide sequences of the CTV minor and major coat pro-teins, a set of primers and FAM-labeled TaqMan probe were de-veloped to detect stem pitting and seedling yellows CTV strains(VT and T3 genotypes). This assay was accurate when the twoprimers and TaqMan sets were combined and allowed the simul-taneous detection of CTV and differentiation of mild and severestrains of the virus. This test successfully distinguished all 25 se-vere from 22 mild isolates from an ad hoc group of CTV isolatesfrom the different collections.

COMPARISON OF FUNGAL DNA ESTRACTION PROTO-COLS FROM DECAYED WOODY TISSUES. M. Saracchi and F.Rocchi. Istituto di Patologia Vegetale, Università degli Studi, ViaCeloria 2, 20133 Milano, Italy. E-mail: [email protected]

Rapid identification of wood-rotting fungi in absence of fruit-ing bodies is one of the keystones in the diagnosis of these diseasesand the management of urban and ornamental green spaces Theaim of this research was the comparison of fungal DNA extractionprotocols, directly from different decayed woods, in order to ex-tract the nucleic acids of the pathogens suitable to be amplifiedand sequenced. No information is apparently available on theavailability of a single protocol for analysing woody tissues from awide range of species. Considering the chemical composition ofthe wood, particular attention was paid to protocols able to re-move high quantity of polysaccharides and polyphenolic com-pounds that commonly reduce or hamper PCR reactions. Two dif-ferent commercial kits and two protocols described in the litera-ture (Ziegenhagen et al., Plant Mol. Biol. Reptr. 11: 117-121, 1993;Kelly et al., Physiol. Mol. Plant Pathol. 52: 392-409, 1998) forDNA extraction from leaves and shoots of many herbaceous and



woody species, were compared. Further steps were added to thelatter of the two protocols, to improve its capacity to remove in-hibiting compounds. The comparison was carried out on speci-mens collected from some woody plant species. The results, basedon PCR products quality and sequencing data, point out the suit-ability of DNAs extracted by means of both commercial kits andthe modified protocol, based on the use of hot CTAB buffer treat-ments. Further trials need to be conducted to test the suitability ofthese protocols for a higher number of woody plant species.

STUDIES ON THE CARPINUS BETULUS DECLINE IN THEHISTORICAL GARDEN OF “VILLA ARESE-BORROMEO” ATCESANO MADERNO. M. Saracchi, F. Rocchi and M. Vaghi. Is-tituto di Patologia Vegetale, Università degli Studi, Via Celoria 2,20133 Milano, Italy. E-mail: [email protected]

Villa Arese-Borromeo, a historical complex dating back to theseventeenth century, includes a garden characterized by morethan 650 European hornbeam (Carpinus betulus), from 10 to 90years old, planted in rows. This is one of the largest hornbeamstands in Europe. On the bark, along the trunks and the biggestbranches, large lesions were observed with oustanding red clups,similar to resin, gathered in more or less numerous groups (redtype cankers). Moreover, on the same cortical surfaces, small glo-bose fruiting bodies were present, from which, during humidweather, long and yellowish cirri came out (yellow type cankers).The involved branches parch in few years and, if the main trunkis affected, the entire tree could die. Detailed and repeated in-spections on each tree allowed to determine the distribution andseverity of the disease. 251 out of 652 trees were symptomatic(38.5%): 92 showed only the yellow type canker, 84 only the redtype, and on 75 plants both types of cankers. The lenght ofcankers varied from few centimetres up to 2 m, generally those ofthe yellow type were the longest. Analyses of red and yellow typecankers ascertained the presence of two different fungal formsthat can be referred, on the basis of their morphocultural andbiomolecular characterization, to the genera Naemospora and En-dothiella, respectively. Their taxonomic position at the specificlevel has not yet ben established. Experimental infection trialsconfirmed that both fungal forms are phytopathogenic.

DOES DEOXYNIVALENOL AFFECT THE ABILITY OF FILA-MENTOUS FUNGI TO COMPETE FOR WHEAT STRAW? S.Sarrocco, F. Matarese and G. Vannacci. Dipartimento di Colti-vazione e Difesa delle Specie Legnose “G. Scaramuzzi”, Sezione diPatologia Vegetale, Università degli Studi, Via del Borghetto 80,56124, Pisa, Italy. [email protected]

Cereals are among the most affected crops by mycotoxins pro-duction. Fusarium graminearum and F. culmorum, the predomi-nant pathogenic species associated with Fusarium head blight(FHB), are producers of the mycotoxin deoxynivalenol (DON)that is frequently found in cereals. Because it is known that de-composing plant material, as wheat straw, serves as inoculumsource for subsequent crops, the aim of this work was to evaluatethe role of DON in the competition for straw colonization amongsoil-borne filamentous fungi. Wheat straw treated with DON,was buried in three natural soils, all with a previous history ofwheat cropping. Mycobiota associated with the treated crop de-bris was evaluated and compared with that obtained from un-treated straw. A general rule for reducing the risk of ear infectionof wheat by pathogenic Fusarium spp. is to limit residues of in-fected crops in susceptible crop fields, by suppressing saprophyt-ic colonisation or sporulation of toxigenic strains. Among fungi

included in the mycobiota associated with treated crop debris,some Pythium spp. and a Trichoderma sp. isolates were collected.These latter fungi were tested for the ability to reduce sporula-tion and growth of Fusarium strains. Positive results emergedfrom these preliminary experiments represent the starting pointfor further investigations aimed at selecting potential antagonistsfor biocontrol of FHB, as a strategy to prevent production andaccumulation of mycotoxins in cereals.

RNA SILENCING OF THE TRICHOTHECENE BIOSYNTHE-SIS GENE TRI6 IN FUSARIUM CULMORUM. B. Scherm1, M.Orrù1, V. Balmas1, T.M. Hammond2, N.P. Keller2 and Q. Migheli1.1Dipartimento di Protezione delle Piante, Centro interdisciplinaredi eccellenza per lo sviluppo della ricerca biotecnologica e per lo stu-dio della biodiversità della Sardegna e dell’area mediterranea, Uni-versità degli Studi, Via E. De Nicola 9, 07100 Sassari, Italy. 2De-partment of Plant Pathology, University of Wisconsin, Madison,WI 53706, USA. E-mail: [email protected]

Post-transcriptional regulation of eukaryotic genes through in-terception and degradation of mRNA is known as RNA silencing.This mechanism is activated by an RNAse III enzyme, which di-gests double-stranded RNA (dsRNA) molecules into 21- to 25-bpfragments. These fragments (siRNAs) are incorporated into acomplex of proteins, the “RNA-induced silencing complex”(RISC), which uses the incorporated siRNAs to target and de-grade mRNA with complementary sequences. It was recentlydemonstrated that inverted repeat transgenes (IRT) are efficientactivators of RNA silencing in fungal species. The aim of thisstudy was to evaluate whether RNA silencing could be applied tosuppress mycotoxin production in the plant pathogen F. culmo-rum (W.G. Smith) Sacc., incitant of crown and foot rot on wheat.Transformation of a highly virulent strain of F. culmorum withIRT-containing sequences corresponding to the trichothecenebiosynthesis gene tri6 was achieved by using the hygromycin Bresistance gene hph as selectable marker in PEG-mediated co-transformation of fungal protoplasts. The pattern of integrationindicates that most transformants underwent homologous recom-bination events with partial deletion of the endogenous tri6 gene.A subset of transformants possessing both the endogenous geneand the tri6-specific IRT construct were selected for further stud-ies. The tri6-specific IRT did not alter physiological characteris-tics, such as spore production, pigmentation, and growth rate onsolid media. Pathogenicity assays are being carried to evaluatewhether impairment in deoxynivalenol production in the tri6-IRTstrains correlates with a loss of virulence.

Work funded by the Ministry of University and Research(PRIN 2005: Fusarium crown and foot rot of wheat: effect ofplant defense mechanisms on pathogenicity and on mycotoxinproduction).

DIAGNOSIS OF LATENT INFECTION CAUSED BYMONILINIA LAXA ON SWEET CHERRIES BY TRADITION-AL AND MOLECULAR METHODS. S. Sharrawi1, I. Penti-mone1, T. Yaseen2, L. Schena3, A. Ligorio1, A. Ippolito1 and F.Nigro1. 1Dipartimento di Protezione delle Piante e MicrobiologiaApplicata, Università degli Studi, Via Amendola 165/A, 70126,Bari, Italy. 2Istituto Agronomico Mediterraneo, Via Ceglie 9, 70010Valenzano (BA), Italy. 3Dipartimento di Gestione dei Sistemi Agrarie Forestali, Università Mediterranea, Località Feo di Vito, 89060Reggio Calabria, Italy. E-mail: [email protected]

Monilinia laxa is the causal agent of brown rot, one of the



most important diseases of sweet cherries in southern Italy. Thepathogen can elicit latent infections whose detection is a criticalfactor for developing an effective control strategy, as well as ap-propriate postharvest handling procedures. Usually, latent infec-tions are diagnosed with traditional techniques, i.e. fungal isola-tion on agarized media from superficially sterilized tissues, freez-ing or dipping surface-sterilized fruits in a paraquat solution. Inaddition, retailers often ask for guarantees on fruit quality con-cerning possible development of storage rots. Some traditionalprocedures (surface-sterilization, paraquat solution and freezing),compared for two seasons (2006 and 2007), clearly demonstratedthat, under favourable conditions, the incidence of latent infec-tions can reach 100%. Beside the inefficiency, these proceduresare time consuming and require specialized personnel for fungalidentification. A molecular method was thus developed for therapid and early detection of M. laxa latent infections. IGS regionof the fungus was amplified, cloned, sequenced, and used to de-sign species-specific primers. These primers enabled the specificdetection of M. laxa DNA among DNAs from a wide range ofdifferent fungal species. Moreover, this method detected earlybrown rot infection in buds, flowers, and fruits of sweet cherriescvs Bigarreau and Ferrovia. IGS sequencing for M. frucigena andM. fructicola is in progress, in order to develop specific primersets for more rapid and single-step PCR identification in differenthost species.

EVALUATION OF SOME CHEMICALS AS INDUCERS OF RE-SISTANCE IN TOMATO PLANTS AGAINST PSEUDOMONASSYRINGAE pv. TOMATO. S. Silvestri, C. Moretti, P. Ferranteand R. Buonaurio. Dipartimento di Scienze Agrarie e Ambientali,Università degli Studi, Borgo XX Giugno 74, 06121 Perugia, Italy.E-mail: [email protected]

Potassium monophosphate, potassium diphosphate, potassi-um permanganate, calcium oxide and potassium phophate buffer(pH 7) as well as acibenzolar-S-methyl were tested for their ca-pacity to suppress tomato bacterial speck caused by Pseudomonassyringae pv. tomato. Basal leaves of tomato plants (cv. PS1296)were sprayed with the above mentioned chemicals and the upperleaves were inoculated with a suspension of the bacterium at 106

cfu ml-1, three days after the treatments. Among the chemicalsused, potassium phosphate buffer treatment significantly and sys-temically protected tomato plants from the disease though to atlesser extent respect to the acibenzolar-S-methyl. The protectiveeffect was expressed through the reduction of the leaf surface in-fected, number of bacterial spots per leaflet, spot diameter andbacterial growth in planta. Further experiments are in progress toestablish whether the resistance is mediated by salicylic acid.

Research funded by the FISR SIMBIO-VEG Project (2005-08).

DIFFUSION OF TWO DIFFERENT ISOLATES OF CITRUSTRISTEZA VIRUS IN SICILY. G. Sorrentino1, S. Davino2, M.Guardo1, M. Davino2 and A. Caruso1. 1CRA, Istituto Sperimenta-le per l’Agrumicoltura, Corso Savoia 190, 95024 Acireale (CT),Italy. 2Dipartimento di Scienze e Tecnologie Fitosanitarie, Univer-sità degli Studi, Via S. Sofia 100, 95123 Catania, Italy. E-mail: guido. [email protected]

In the area where the first large outbreak of Citrus TristezaVirus (CTV) occurred in the province of Catania (Sicily), a severeCTV isolate (CTV-DS2) was discovered in 2002. In the years thatfollowed the area around the focus was monitored to determine

the spreading of this isolate. Monitoring was carried out by DAS-ELISA and DTBIA and characterization and sequencing by mo-lecular analysis (SSCP) of the P20 and P23 genes. During moni-toring a mild CTV-isolate (CTV-DS1) was detected in a small plotat the borders of the original focus. CTV-DS1 occurred in a smallarea, in 13-14-years old sweet oranges cv. Tarocco O.L. grafted onsour orange, bordering a plot with 100% CTV-infected trees ofmandarin cv. Fortune grafted on sour orange. Field observationaimed at estimating the movement and rate of spread of both viralisolates and at identifying possible aereas of coexitance and inter-actions of these strains. The severe isolate present in the originalfocus showed a fast spreading inside the plots infected since 2002and in the bordering groves, so as to enlarge considerably its dis-tribution. By contrast, the mild isolate moved slowly, remainingpractically restricted to the area in which it was originally found.At the borders of the two foci both isolates isolates occurred insome sweet orange cv. Navelina OL grafted on sour orange. Thesedoubly infected trees declined rapidily and died.

HIBISCUS MOSCHEUTOS subsp. PALUSTRIS, NEW HOSTOF VERTICILLIUM DAHLIAE. V.M. Stravato1, G. Carannante1,M. Quaglia2 and C. Cappelli2. 1Genista S.r.L., Strada Statale Flac-ca, 04022 Fondi (LT), Italy. 2Dipartimento di Scienze Agrarie eAmbientali. Università degli Studi, Borgo XX Giugno 74, 06121Perugia, Italy. E-mail: [email protected]

In the last three years near the lake of Fondi (Latina, centralItaly), severe symptoms of stunting and wilting were observed onsome plants of Hibiscus moscheutos subsp. palustris. an ecologi-cally relevant, very rare wild species producing appreciated beau-tiful flowers, recorded in Tuscany and Latium, and constitutingimportant example of biodiversity in the marsh areas. The severi-ty of the symptoms prompted more detailed investigations to un-derstand the etiology of the disease. The results of our investiga-tions, based on isolations from infected stems and artificial inocu-lations of healthy plants, demonstrated that the fungus Verticilli-um dahliae Kleb., that was consistently isolated from infected tis-sues, is the causal agent of the disease. To our knowledge, this isthe first report of V. dahliae on H. moscheutos subsp. palustris.The pathogen is a polyphagus and ubiquitous fungus recorded inItaly from a wide range of plant species, including another hibis-cus (Hibiscus cannabinus L.). Infection of H. moscheutos subsp.palustris could origiante from inoculum spreading from cultivat-ed infected fields. In the province of Latina different susceptiblevegetables and fruits trees are widely grown, so that superficialwater could play an important role in the dissemination of V.dahliae towards the lake of Fondi.

SURVEY OF VIRUS DISEASES OF TABLE GRAPE IN SICILY.M. Tessitori1, E. Buonocore2 and R. La Rosa1. 1Dipartimento diScienze e Tecnologie Fitosanitarie Università degli Studi, Via S.Sofia 100, 95123 Catania, Italy. 2Regione Siciliana, Servizio Fi-tosanitario, U.O. 54-O.M.P. di Acireale, Contrada Fanello, 97019Vittoria (RG), Italy. mtessitori@ unict.it

Sicily ranks second in Italy for table grape production. Be-cause information on the sanitary conditions of this crop in Sicilyare scanty, a survey for virus diseases was conducted in 10 com-mercial vineyards (in greenhouse or arbor) located in differentprovinces of the island. In autumn 2006 mature canes were col-lected from a total of 53 individual vines that showed virus dis-ease symptoms (60% of the samples) or were apparently healthy(40%). Different symptoms were observed, i.e. leafroll, leaf mo-



saic, fanleaf, fasciations of shoots and bunches, and short intern-odes. ELISA tests on phloem scrapings were made using com-mercial kits (Agritest, Valenzano, Italy) for Grapevine virus A(GVA), Grapevine fanleaf virus (GFLV), Grapevine leafroll-associ-ated virus 1 (GLRaV-1), Grapevine leafroll-associated virus 3(GLRaV-3) and Grapevine fleck virus (GFkV). Results showedthat 99% of the tested vines were infected even if only 60% ofthem was symptomatic in the field. Of the positive samples, 85%had mixed infections with different virus combinations, whereas15% was infected only by GFkV. GLRaV-3 and GFkV were themost widespread viruses (90.5% and 79.2%, respectively) where-as GFLV was the least represented (16.9%). RT-PCR analyses arein progress to confirm ELISA results and to check a larger num-ber of samples.

PARTIAL NUCLEOTIDE SEQUENCE OF CAPER LATENTVIRUS. A. Tiberini and L. Tomassoli. CRA, Istituto Sperimenta-le per la Patologia Vegetale, Via C.G. Bertero 22, 00156 Roma,Italy. E-mail: [email protected]

Virus origin, evolution and genetic variability represent a cur-rent and interesting issue in plant virology. In recent times, manypapers reported on these aspects to better understand theprocess involved in plant virus evolution. In this context, a mo-lecular study was recently initiated of Caper latent virus (CapLV),a member of the genus Carlavirus, that infects latently caper innature and occurs in all the minor islands of Sicily where caper isgrown for commercial purposed. Since CapLV has probably co-existed with caper for long time in very closed ecosystems, it rep-resents an interesting virus to be characterized molecularly andcompared to members of the genus Carlavirus. In this study,ORF1, encoding the replicase gene of CapLV was amplified (Su-perscript One-Step RT-PCR for Long Templates, Invitrogen,Carlsbad, CA, USA) using specific primers designed on two par-tial short sequences (1000 bp each) previously obtained in the 5'and 3' portion, respectively, of the gene in question. The resulting5,500 bp amplicon was cloned (TA Cloning kit, Invitrogen) andsequenced. Results from nucleotide analysis (BLAST and FAS-TA) demonstrated that ORF1 of CapLV shares 60% to 75%identity with that of six other carlaviruses for which sequence in-formation is available in GenBank. In particular, CapLV was clos-est to Helenium virus S (HelVS) and Garlic latent virus (GaLV)with a homology of 75% and 73%, respectively. Further, a totalof fifteen CapLV isolates from different islands of Sicilian Archi-pelagoes were characterized and analyzed for a preliminary mo-lecular phylogenetic study of the genus Carlavirus.

Research supported by the Sicily Region in the framework ofthe project: Caratterizzazione, miglioramento genetico-sanitario edifesa del cappero delle isole minori della Sicilia

PRELIMINARY INVESTIGATION ON ASPARAGUS DIS-EASES IN SICILY. L. Tomassoli1, A. Zaccaria1, D. Valentino2

and G. Tamietti2. 1CRA, Istituto Sperimentale per la PatologiaVegetale, Via C.G. Bertero 22, 00156 Roma, Italy. 2Dipartimentodi Valorizzazione e Protezione delle Risorse Agroforestali, Sezionedi Patologia Vegetale, Università degli Studi di Torino, Via Leonar-do da Vinci, 44, 10095 Grugliasco (TO), Italy. E-mail: [email protected]

The green-quality asparagus (Asparagus officinalis L.) is apromising crop in Sicily because of the favourable soil and cli-matic conditions along the coasts, mainly in the provinces of

Messina, Trapani, Siracusa and Agrigento. In these areas, aspara-gus is grown in semi-forced culture under tunnel and in the openfield, its season usually running from January to April. Since as-paragus is a recent crop, no information is available on diseasesand relative causal agents. Therefore, the aim of our work was tosurvey asparagus fields to assess the occurrence of diseasescaused either by pathogens that normally occur in this crop inother Italian regions or, being indigenous, are new to this host. Asascertained by a two-year survey, the sanitary status of the cultiva-tions appeared generally good. However, plants showing severestunting, decline, and root rot were observed in a plastic-house inearly 2007 at Mazara del Vallo. Fusarium proliferatum (Matsushi-ma) Nirenberg was associated with this condition. We supposethat a thermal stress due to a prolonged closure of the tunnel mayhave predisposed the crop to the disease. Spears and ferns fromsymptomless plants were also analyzed for the presence of virus-es. Asparagus virus 1 (AV-1) and Asparagus virus 2 (AV-2) werefound in two different areas with a significantly different inci-dence. These viruses are widely spread both in Italy and in theworld. Until now, no other viruses reported from asparagus havebeen detected.

CHEMOTYPING OF FUSARIUM GRAMINEARUM FROMDURUM WHEAT IN AN AREA OF EMILIA ROMAGNA. S.Tonti1, A. Prodi1, S. Sandalo1, D. Pancaldi2, L. Flamini3 and A.Pisi1. 1Dipartimento di Scienze e Tecnologie Agroambientali, AlmaMater Studiorum, Università degli Studi, Via Fanin 42, 40127Bologna, Italy. 2Dipartimento di Protezione e ValorizzazioneAgroalimentare, Alma Mater Studiorm, Università degli Studi, ViaFanin 44-46, 40127 Bologna, Italy. 2ASSAM, Agenzia Servizi Set-tore Agroalimentare Marche, Servizio Fitosanitario Regionale, ViaAlpi 21, 60131 Ancona, Italy. E-mail:[email protected]

Fusarium graminearum is one of the main causal agents offusarium head blight (FHB) of wheat. F. graminearum populationcan be divided into two chemotypes based on the production ofthe trichothecenes deoxynivalenol (DON) and nivalenol (NIV).DON-producing isolates can be further distinguished on the ba-sis of the predominant acetyl DON derivative that produces 3-acetyl DON (3-AcDON) or 15-acetyl DON (15-AcDON). In thisinvestigation, fungal isolates collected between 2006 and 2007from symptomatic spikes of durum wheat in several fields,around Bologna (Emilia-Romagna region, northern Italy), weretested with a multiplex version (Starkey et al.,, Fungal Genet.Biol., doi: 10.1016/j.fgb.2007.03.001, 2007) of the chemotype-specific PCR proposed by Ward et al. (Natl. Acad. Sci. USA 99:9278-9283, 2002). All the three fungal chemotypes were found.In particular, of the 66 isolates tested, 79% belonged to the 15-AcDON chemotype, 15% to the 3-AcDON and 6% to NIV. The15-AcDON chemotype was the most frequent. This is the firsttime that a population of F. graminearum, exclusively isolatedfrom durum wheat from the area under investigation, was exam-ined for chemotypes. Taking into consideration the variability ofthe Italian environmental characteristics, it would be desirable tomonitor wheat fields from all over the country, especially wheredurum wheat prevails, to better understand the distribution of F.graminearum chemotypes in this country.

RADIO FREQUENCY IDENTIFICATION TECHNOLOGYFOR IMPROVING TRACEABILITY IN THE GRAPEVINENURSERY SECTOR. E. Triolo1, A. Luvisi1, R. Bandinelli2 E. Ri-naldelli2 and M. Pagano2. 1Dipartimento di Coltivazione e Difesadelle Specie Legnose “G. Scaramuzzi”, Sezione di Patologia Vege-



tale, Università degli Studi, Via del Borghetto 80, 56124 Pisa, Italy.2Dipartimento di Ortoflorofrutticultura, Università degli Studi diFirenze, Via delle Idee 26, 50019 Sesto Fiorentino (FI), Italy. E-mail: [email protected]

Radio frequency identification (RFID) is an innovating systemfor developing traceability programs in agriculture, as widely ex-emplified by other fields of applications, i.e. logistics, animalidentification and environmental monitoring. In the grapevinenursery sector, this technology could be useful for increasing con-sumers’ confidence, thanks to the possibility of checking the “his-tory” of grapevines used for producing a given wine, besides as-sisting the logistics of the production phase of the farmingprocess. The aim of our trial is the evaluation of the the effects ongrowth following the implantation of microchips into grapevines,and the development of an effective procedure for online manag-ing of information associated to chips. The trial was initiated in2007 in the Vivai New Plants, Cenaia (Pisa, central Italy) usingfive different grape clones supplied by the Associazione ToscanaCostitutori Viticoli (TOS.CO.VIT., San Piero a Grado, Pisa, Italy;www.toscovit.it). Clones (Sangiovese I-SS-F9-A5-48, Prugnologentile I-Bruscello, Colorino I-US-FI-PI-10, Trebbiano toscano I-S.Lucia 12 and Vernaccia di S. Gimignano I-VP6) were grafted on1103P, inserting the microchips (Transponder Glass TAG) withtwo different procedures, encompassing TAG insertion into themedulla or under the bark, with the assistance of a specific ma-chine. Each inserted TAG is identified by a number readable by aPalm-PC, linked with a simple identification file. To consult acomplete grapevine identification file with attached technical in-formation, users (farmers, consumers) will have access to a web-site, actually under construction, and enter an online database, us-ing the identification number supplied by the Palm-PC.

OVER-EXPRESSION OF CHITINASE AND ß-1,3-GLU-CANASE GENES IN ORANGE FRUIT TREATED WITH AU-REOBASIDIUM PULLULANS AND CHITOSAN. M.C. Trullo1,L. Schena2, I. Pentimone1, A. Ligorio1, F. Nigro1 and A. Ippoli-to1. 1Dipartimento di Protezione delle Piante e Microbiologia Ap-plicata, Università degli Studi, Via Amendola 165/A, 70126 Bari,Italy. 2Dipartimento di Gestione dei Sistemi Agrari e Forestali,Università Mediterranea, Località Feo di Vito, 89060 Reggio Cala-bria, Italy. E-mail: [email protected]

Chitosan and Aureobasidium pullulans, strains L47 and 547,are known for their activity in controlling a number of post-har-vest diseases of fruits and vegetables. The mechanisms by whichthese alternative control means exert their activity are not fullyelucidated, although it has been inferred that, among other mech-anisms, they are able to induce resistance in the host. To confirmthis hypothesis at a molecular level, the expression of two genes,known to be involved in the host resistance (chitinase and b-1,3-glucanase), was evaluated by real-time PCR in oranges cv. Valen-cia late at different level of maturity (veraison and full-ripening).ATP-synthase was utilised as a housekeeping non-regulated refer-ence gene. At the beginning of ripening the relative transcript lev-el of chitinase was up-regulated in all treated fruits by 518- (strainL47), 726- (strain 547) and 1790-fold (chitosan). In the samefruits b-1,3-glucanase expression was increased by L47 and 547(55- and 20-fold, respectively) and to a minor extent by chitosan(5.4 fold). Full-ripen fruits were less reactive compared to thosein the veraison stage. In particular, chitinase expression was up-regulated by 20, 83 and 259 fold in fruits treated with 547, L47and chitosan, respectively. Very limited increases of expressionwere shown by the b-1,3-glucanase gene. Our data demonstratethat L47, 547 and chitosan are able to induce resistance in orange

tissues; however their action is strongly influenced by the ripen-ing stage. Further studies are in progress to identify other genesinvolved in the resistance induced by strain 547 and chitosan inoranges.

EFFECT OF DRY MILLING ON TOXIGENIC FUNGI CONTA-MINATION OF CORN. G. Venturini, M. Moretti, G. Assanteand A. Vercesi. Istituto di Patologia Vegetale, Università degli Stu-di, Via Celoria 2, 20133 Milano, Italy. E-mail: giovanni.venturini@ unimi.it

Mycotoxin contamination occurs with increasing frequency incorn produced in Northern Italy. In order to evaluate the effectsof dry milling on toxigenic fungi associated with corn, one batchof cv. Costanza was sampled in five subsequent processing stages:kernels, flaking grits, coarse grits, cornmeal and flour. The highcontamination level on the kernel surface (2.5 x 105 CFU/g freshweight), was mainly due to Fusarium verticillioides. Other fungi,namely Aspergillus flavus and A. niger and several Penicilliumspecies, were less frequently found. Dry milling induced a strongdecrease in fungal contamination, mostly caused by the reductionof F. verticillioides CFUs. Inner seed tissues and flour were stillcontaminated mainly by F. verticillioides, while contamination byA. flavus and A. niger decreased following germ removal, but in-creased in the final product. Only the 17.6% of the A. flavusstrains isolated were able to produce aflatoxins. No toxigenicPenicillium species were found. These results show that the majorrisk for mycotoxin contamination in the examined samples is dueto F. verticillioides and to a lesser extent, to A. flavus. Furtherstudies are needed in order to investigate the distribution of F.verticillioides in the corn-growing areas in northern Italy and thetoxigenic capability of the extant strains.

DETECTION AND PHYSIOLOGICAL CHARACTERIZATIONOF FUSARIUM SOLANI f. sp. CUCURBITAE RACE 1 FROMSHELTERED ZUCCHINI CULTIVATIONS IN EMILIA RO-MAGNA. A. Veronesi, C. Sigala, G. Alberoni and R. Roberti.Dipartimento di Protezione e Valorizzazione Agroalimentare, AlmaMater Studiorum, Università degli Studi, Via Fanin 46, 40127,Bologna, Italy. E-mail: [email protected]

Crown and foot rot of zucchini has been observed in five shel-tered cultivations in Emilia Romagna (northern Italy) from 2005to 2007. The objective of this research was the identification ofthe casual agent of the disease and the study of the virulence andphysiological variability of its monosporic cultures. On the basisof host specificity and morphological characteristics, thepathogen was identify as F. solani f. sp. cucurbiate W.C. Snyder &H.N. Hansen. Isolations from necrotic tissues gave 100 single-spore-cultures. The DNA transcriber elongation factor (TEF)from 20 selected monosporic cultures was amplified, sequencedand placed in a Fusarium database. All isolates were confirmed asF. solani f.sp. cucurbitae race 1. The 20 monosporic cultures inoc-ulated on zucchini under controlled conditions showed differentdegrees of virulence, infecting 61-97% of inoculated plants. Theywere also able to produce different amounts of pathogenesis-re-lated enzymes, such as cellulase, pectin lyase, pectinase, poly-galacturonase and protease, whose activity was tested in fungalcrude protein extracts, using the agarose diffusion assay method.Monosporic cultures plated on potato dextrose agar with the ad-dition of carnation leaf powder, exhibited different growth ratesat 17, 23 and 28°C in the dark or in the light.



DIFFERENCES IN THE MICROFUNGAL COMMUNITY BE-TWEEN SPRING AND WINTER COMPOSTS. A.M. Vettraino,S. Franceschini and A. Vannini. Dipartimento di Protezione dellePiante, Università degli Studi della Tuscia, Via S. Camillo de Lellis,01100 Viterbo, Italy. E-mail: [email protected]

Composting is a general treatment method used to recycle dif-ferent sources of materials such as municipal, yard and other kindof organic wastes. The high organic matter content as well as thebiological activity make composts useful for a variety of applica-tions (fertilization, soil erosion, bioremediation). The biomass ra-tio of fungi to prokaryotes in compost is 2:1 highlighting the fun-damental role of fungi in polymer degradation and their impor-tance as part of the compost microflora. Focusing on the micro-fungal community, we assessed some biological differences be-tween two different green composts produced with materials col-lected in winter and spring 2006. The total microbial activity wasmeasured through enzyme activity using the FDA hydrolysis as-say. Isolation of fungi from compost was performed on PDAamended with streptomycin at 20°C. Fungal species were identi-fied according to their morphological traits. For each sample thetotal fungal load, their concentration and the statistic index ofrichness, dominance and evenness were determined. The estimat-ed enzymatic activity was comparable to that reported in the lit-erature for other composts and soils. As expected, spring com-post had a higher fungal load and a wider diversity consequent tothe influence of the season on the microfungal community com-position.

ANTIBIOTIC AND PLANT GROWTH PROMOTION ACTIVI-TY OF TRICHODERMA KONINGININS. F. Vinale1, G.Chiessa4, K. Sivasithamparam2, E.L. Ghisalberti2, R. Marra1, P.Conte5, A. Piccolo5, V. Aloj1, D. Turrà1, S. Lanzuise1, M. Ruocco3,S.L. Woo1 and M. Lorito1. 1Dipartimento di Arboricoltura Botanicae Patologia Vegetale, Università degli Studi di Napoli “Federico II”,Via Università 100, 80055 Portici (NA), Italy. 2University of West-ern Australia, 35 Stirling Highway, Crawley, Perth, WA. Australia.3Istituto di Protezione delle Piante del CNR, Via Università 133,Portici (NA), Italy. 4Instituto Nacional de Tecnología Agropecuaria,Aristizabal y De Los Reseros, Hurlingham, Argentina. 5Centro Inter-dipartimentale di Spettroscopia di Risonanza Magnetica Nucleare(CERMANU), Università di Napoli “Federico II”, Via Università100, 80055 Portici (NA), Italy. E-mail: [email protected]

The production of Trichoderma secondary metabolites withantibiotic activity is a well documented phenomenon. However,only a few reports deal with the ability of antagonistic fungalstrains to produce compounds acting as plant growth promotingfactors. Some Trichoderma secondary metabolites significantly in-hibit the growth of etiolated wheat coleoptiles at a relatively highconcentration (10-3 M), but no effect is registered at lower doses(range from 10-4 to 10-6 M). Such compounds may act as planthormones, which typically have an optimum activity between 10-5

and 10-6 M, while having an inhibitory effect at higher concentra-tions. In this work, we isolated koninginin A (2-Hexyl-3,10-dioxa-tricyclo[6.2.2.04,9]dodec-8-en-7-one), koninginin B (8-Hy-droxy-2-(1-hydroxy-heptyl)-2,3,4,6,7,8-hexahydro-chromen-5-one) and its diastereoisomer koninginin E, produced by a biocon-trol strain of T. koningii. Antifungal activity tests with koningininB and E revealed a weak inhibitory activity on Rhizoctonia solaniand Pythium ultimum. In contrast, complete inhibition of bothpathogens was achieved with koninginin A at 10 and 100 µg, re-spectively. The plant growth promotion effect of koninginins wasevaluated by monitoring the germination rate of tomato seedsand the length of seedlings grown in the presence of these sec-

ondary metabolites as applied at different concentrations.Koninginin A, that showed the highest antibiotic activity, did notimprove significantly seedling growth. On the contrary,koninginin B and E produced a clear-cut growth promotion ef-fect when applied at 10-5 and 10-6 M.

CHARACTERIZATION AND IDENTIFICATION OF NEWTRICHODERMA SPECIES COMPROMISING THE COMMER-CIAL PRODUCTION OF PLEUROTUS IN ITALY. S.L. Woo1,M. Ruocco2, F. Vinale1, R. Marra1, S. Lanzuise1, D. Turrà1, V.Aloj1, P. Marinelli1, C.P. Kubicek3, I. Druzhinina3 and M.Lorito1. 1Dipartimento di Arboricoltura Botanica e Patologia Vege-tale, Università degli Studi di Napoli “Federico II”, Via Università100, 80055 Portici (NA), Italy. 2Istituto di Protezione delle Piantedel CNR, Via Università 133, 80055 Portici (NA), Italy. 3MicrobialBiochemistry and Gene Technology Department, Institute forChemical Engineering, Technical University of Vienna, Getreide-markt 9/166-5, 1060 Vienna, Austria. E-mail: [email protected]

Trichoderma spp. attacks to Pleurotus ostreatus (oyster mush-room) cutivations are relatively recent, and new to Italy. Previous-ly, Trichoderma aggressivum forms have caused severe greenmould epidemics in Agaricus bisporus (champignon) in NorthAmerica and Europe. It is unknown if Trichoderma spp. compro-mising the production of oyster mushrooms are the same as thosecausing disease to champignons. Samples were collected from allphases of P. ostreatus production; isolated by dilution plating, andpure Trichoderma cultures were obtained. Fungal species, includ-ing Trichoderma, were recovered in the initial compost stages(CFU’s 9.2×104 to 2.9×108 per g of compost), were not detectedin post-pasteurization or grain spawn inoculation, but were pres-ent in subsequent stages of incubation and fructification (CFU’s5.2×106 to 4.1×108 per g). The phenotypic, genetic and biologicalcharacters of all isolates were analyzed. Trichoderma isolatesproblematic to P. ostreatus differed in mycelial growth and sporu-lation from isolates used in biological control and from the formspathogenic to A. bisporus, and they were not mycoparasitic to P.ostreatus. Genetic markers specific to the two T. aggressivumforms attacking Agaricus were not detected in any of the Tricho-derma spp. associated with P. ostreatus. Identity analysis usingITS sequences, TrichOkey (www.isth.info) and NCBI BLAST in-dicated that many of the Trichoderma isolates associated with P.ostreatus were not similar to any existing species. These isolatesare taxonomically distinct and have been identified as two newspecies, T. fulvum sp. nov. and T. pleurotophilum sp. nov.

POTENTIAL USE OF ESSENTIAL OILS ALONE OR IN COM-BINATION WITH ANTAGONISTIC BACTERIA FOR SOILSTERILIZATION. M. Zaccardelli and F. Campanile. CRA, Isti-tuto Sperimentale per le Colture Industriali., Strada Statale 18 n. 204, 84091, Battipaglia (SA), Italy. E-mail: [email protected]

A large number of essential oils, extracted from medicinalplants, have antimicrobial activity. Against soil-borne pathogens asFusarium spp., Rhizoctonia solani, Sclerotinia spp., essential oilsextracted from Carum carvi L., Melissa officinalis L., Origanumvulgare L., Rosmarinus officinalis L., Thymus vulgaris L. and Ver-bena officinalis L., are among the most active. Moreover, these es-sential oils strongly inhibit germination of weeds. For these char-acteristics, these six essential oils are potential candidate for soilsterilization. To investigate their impact on the soil, each oil wasseparately added to pots containing natural soil. After irrigation



with an aqueous solution at 1% concentration, each pot wassealed in a plastic bag at 25°C to simulate a chemical soil treat-ment. Pots treated only with water were used as control. Afterthree days, plastic bags were removed and hydrolase activity, oneof the biological indexes that most rapidly respond to soil treat-ments, was measured on soil samples. Respect to control soil, hy-drolase activity was lower, especially in soils treated with oils ex-tracted from Thymus vulgaris L. and Verbena officinalis L. To in-vestigate the possibility to integrate essential oils treatments withantagonistic bacteria, the effects of these oils on thirteen genetical-ly different Bacillus spp., that showed antibiosis activity, were test-ed. All the essential oils were not toxic for any of the bacterialstrains used; only two strains showed some inhibition by oils fromrosemary and verbena. Further treatments on soils artificially con-taminated with soil-borne pathogen are in progress.

IN VITRO CULTURE OF ASTER SEDIFOLIUS ANDSOLANUM LYCOPERSICON FOR THE PRODUCTION OFFUNGITOXIC SAPONINS. M. Zaccardelli1, I. Caruso2, F. Cam-panile1 and A. Errico2. 1CRA, Istituto Sperimentale per le ColtureIndustriali, Strada Statale 18 n. 204, 84091 Battipaglia (SA), Italy.2Dipartimento di Scienze del Suolo, delle Piante e dell’Ambiente,Università degli Studi di Napoli “Federico II”, Via Università 100,80055 Portici (NA), Italy. E-mail: [email protected]

Saponins are glycosides with antimicrobial effects commonlyfound in plants. In particular, Aster sedifolius and Solanum lycop-ersicum produce, respectively, high level of triterpenoid andsteroidal saponin with fungitoxic effects. For example, a mix ofastersedifoliosides A, B and C, inhibit the growth of the phy-topathogenic fungi Fusarium solani, Rhizoctonia solani, Sclerotiniasp. and Sclerotium rolfsii; a-tomatine inhibits the growth of F.semitectum, F. solani, S. rolfsii and, expecially, of R. solani, F. oxys-porum and Botrytis sp. In this work, the production was evaluatedof these fungitoxic coumpounds by in vitro cultures of Aster cau-casicus, A sedifolius and S. lycopersicum. In vitro cultures weremade in different conditions, i.e. use of different plant organs forcallus tissue production, growth of the callus tissue in the dark orin the light, different concentration of hormones in the substrate.Fresh or lyophilized callus tissue were added to PDA and the levelof saponins was measured using Trichoderma viride bioassays. Thehighest growth inhibition of T. viride was obtained from callus tis-sue of S. lycopersicum with respect to A. caucasicus and A. sedi-folius. The most active were fresh or lyophilized callus tissue ob-tained from tomato roots and grown in the light or in the dark,but similar effects were observed with other tomato callus tissue.Among Aster spp., the best results were obtained with fresh callustissue from leaves of A. sedifolius, grown in the light with the high-est concentration of hormones. Results suggest that it is possibleto produce fungitoxic saponins by in vitro culture.

SUSCEPTIBILITY OF DIFFERENT GENOTYPES OF CHICK-PEA TO ASCOCHYTA RABIEI IN THE OPEN FIELD. M. Zac-cardelli1, F. Lupo2 and A. Infantino3. 1CRA, Istituto Sperimentaleper le Colture Industriali, Strada Statale 18 n. 204, 84091 Batti-paglia (SA), Italy. 2Dipartimeno di Scienze dei Sistemi Colturali,Forestali e dell’Ambiente, Università degli Studi della Basilicata,Via dell’Ateneo Lucano 10, 85100, Potenza, Italy. 3CRA, IstitutoSperimentale per la Patologia Vegetale, Via C.G. Bertero 22, 00156Roma, Italy. E-mail: [email protected]

Ascochyta rabiei is the most important pathogen of chickpeain the Mediterranean basin. Damages are particularly important

especially when chickpea (Cicer arietinum L.) is sown in autumnor winter. During the warm and humid winter of 2006/2007,heavy attacks of A. rabiei were observed in an experimental fieldin the Sele valley (Campania, Southern Italy). Eight chickpeagenotypes showed symptoms but differences in their incidenceand severity were observed. Disease incidence, expressed as num-ber of killed plants, was assessed in April 2007. The totality of theplants of ecotypes Maglianico, Spinazzola and Sassano was killed(100% incidence), whereas incidence levels of 96%, 68%, 61,5%and 52% were scored for the ecotype Cicerale, the cv. Visir, theecotype Guardia dei Lombardi and the cv. Asia, respectively. Thelowest figure (17,5%) was recorded for the genotype C9112 VT.These results show that local Italian chickpea genotypes are high-ly susceptible and that the use of resistant genotypes is of para-mount importance in southern Italy for crops sown in autumn orwinter. Moreover, the high susceptibility of the resistant cv. Visir,indicates that A. rabiei can overcome rapidly resistance genes ofchickpea. Therefore, breeding programs are necessary to intro-duce in chickpea horizontal rather than monogenic or oligogenicresistance.

IDENTIFICATION OF BIO-ACTIVE COMPOUNDS IN ES-SENTIAL OILS OF MEDICINAL PLANTS TOXIC FOR PHY-TOPATHOGENIC FUNGI AND BACTERIA. M. Zaccardelli1,E. Mancini2, F. Campanile1, E. De Feo2 and E. De Falco2. 1CRA,Istituto Sperimentale per le Colture Industriali, Strada Statale 18 n.204, 84091 Battipaglia (SA), Italy. 2Dipartimento di Scienze Farma-ceutiche, Università degli Studi di Salerno, Via Ponte Don Melillo,84084 Fisciano (SA), Italy. E-mail: [email protected]

Medicinal plants are of much interest for the production ofnatural and potentially eco-compatible essential oils that, besideother biological properties, are able of controlling dangerousphytopathogenic organisms. Previous studies has showon that es-sential oils extracted from Carum carvi L., Foeniculum vulgareMill., Hyssopus officinalis L., Lavandula angustifolia Mill., Majo-rana hortensis L., Melissa officinalis L., Ocimum basilicum L., Ori-ganum vulgare L., Pimpinella anisum L., Salvia officinalis L., Thy-mus vulgaris L. and Verbena officinalis L., are very toxic to severalphytopathogenic fungi and bacteria, when used at 1% concentra-tion. A total of 23 monoterpenes, representative of the main com-ponents of essential oils extracted from the above cited plants,were tested against eight phytopatogenic fungi and four bacteria.Limonene inhibited totally Fusarium sambucinum and F. semitec-tum; linalool inhibited totally Rhizoctonia solani; geraniol inhibit-ed totally Alternaria sp., Botrytis sp., F. sambucinum, F. semitec-tum and Sclerotinia sp.; thymol inhibited totally Botrytis sp., F.sambucinum, F. solani and Sclerotinia sp.; carvacrol inhibited to-tally all eight phytopatogenic fungi; citronellal and b-citronellolinhibited Botrytis sp.; a-terpineol inhibited totally Botrytis sp., F.oxysporum and R. solani; carvone inhibited totally R. solani; cit-rale inhibited totally Alternaria sp., Botrytis sp., F. sambucinum, F.semitectum, F. solani and Sclerotinia sp. Camphor, thymol andcarvacrol, inhibited totally the four phytopathogenic bacteriatested. Linalool, citronellal, b-citronellol, menthone, a-terpineoland carvone, inhibited totally Xanthomonas campestris pv.campestris, Xanthomonas axonopodis pv. alfalfa and Erwinia caro-tovora. Further studies are in progress.

INCIDENCE OF SOFT ROT OF FENNEL FERTILIZED WITHDIFFERENT DOSES OF NITROGEN AND CULTIVATED AF-TER THREE GRAIN LEGUMES AND WHEAT. M. Zaccardelli,D. Perrone, B. D’Onofrio, A. Del Galdo and F. Campanile.



CRA, Istituto Sperimentale per le Colture Industriali di Battipa-glia, Strada Statale 18 n. 204, 84091 Battipaglia (SA), Italy. E-mail: [email protected]

In this work the effects were evaluated of four levels of nitrogenfertilization (0, 60, 120 and 180 kg ha-1) on the incidence of soft rotof fennel grown after three grain legumes (pea, faba bean andchickpea) and wheat. The experimental field was in the Sele Valley(Campania, southern Italy). Soft rot incidence, evaluated at har-vesting, increased with nitrogen fertilization (mean 5.1%) with re-spect to no fertilization (mean 0.8%). The highest incidence wasregistered in fennels fertilized with the highest nitrogen dose andgrown after chickpea (mean 7.35%). Samples of symptomaticplants were collected to isolate pectinolytic agents using semi-selec-tive media and the isolates obtained were purified and tested forpectinolytic activity on potato tuber plugs. Pectinolytic isolateswere analysed by PCR using selective primers designed on pectateliase encoding gene (pel) of Erwinia carotovora. Different isolatesgave the expected fragment of 434 bp.

ROLE OF THE NEUROTOXIN ODAP TO CONTROL FUN-GAL INFECTIONS IN GRASS PEA (LATHYRUS SATIVUS L.).M. Zaccardelli1, A. Piergiovanni2, F. Campanile1 and F. Lupo3.1CRA, Istituto Sperimentale per le Colture Industriali, StradaStatale 18 n. 204, 84091 Battipaglia (SA), Italy. 2Istituto di GeneticaVegetale del CNR, Via Amendola 165/A, 70126 Bari, Italy. 3Dipar-timeno di Scienze dei Sistemi Colturali, Forestali e dell’Ambiente,Università degli Studi della Basilicata, Via dell’Ateneo Lucano 10,85100 Potenza, Italy. E-mail: [email protected]

ODAP (b-N-Oxalyl-a, b-diaminopropanoic acid) is a neuro-toxin that causes to animals and humans severe neurological dis-orders (lathyrism) involving oxidative stress The content of thisneurotoxin in grass pea (Lathyrus sativus L.), that ranges from0.1% to 2.5%, is related to environmental factors and abioticstresses. The toxin precursor, b-(isoxazolin-5-on-2-yl)-L-alanine(BIA), is exuded by the roots of some leguminous plants and hastoxic effects on mammalian cells, yeasts, phytopathogenic fungi,unicellular green algae and higher plants. Its broad antifungal ac-tivity suggests that BIA might play a role as allelochemical. L.sativus has a high resistance to biotic and abiotic stresses, suppos-edly because of these neurotoxic compounds. To establish ifODAP has antifungal activity as BIA, crude extracts of the neu-rotoxin were assayed in vitro against different phytopathogenicfungi. Moreover, the content of ODAP was determined in seedsof 14 different genotypes of grass pea, cultivated in two differentenvironments (a plane area near the sea and an internal hillyarea), to establish the influence of genotype and environment onits concentration. First results of in vitro tests showed no effect ofODAP on Ascochyta sp., Alternaria sp. Botrytis sp., Fusariumsolani, F. oxysporum, Rhizoctonia solani, Sclerotinia sp. ODAPcontent was up to three times higher in the seeds of plants grownin the hills than on the plane for all genotypes, confirming thehigher effect of the environment with respect to the genotype.

EFFECTS ON PHYTOPATHOGENIC FUNGI AND BACTE-RIA OF ESSENTIAL OILS EXTRACTED FROM DIFFERENTSPECIES OF SAGE. M. Zaccardelli1, G. Roscigno2, F. Cam-panile1, E. De Falco2 and V. De Feo2. 1CRA, Istituto per le Col-ture Industriali, Strada Statale 18 n. 204, 84091 Battipaglia (SA),Italy. 2Dipartimento di Scienze Farmaceutiche, Università degli Stu-di di Salerno, Via Ponte Don Melillo, 84084 Fisciano (SA), Italy. E-mail: [email protected]

The goal of this work was the evaluation of the effects of es-sential oils, extracted from six different species of sage, on thegrowth of phytopathogenic fungi and bacteria. The species ofsage were Salvia greggii A. Gray, Salvia mellifera Greene, Salviaafricana L., Salvia rutilans Carrière, Salvia officinalis L. ‘Icterina’and Salvia munzii Epling; the fungi tested were Alternaria sp.,Botrytis sp., Fusarium oxysporum, F. sambucinum, F. semitectum,F. solani, Rhizoctonia solani and Sclerotinia sp.; the bacteria testedwere Erwinia carotovora and Xanthomonas campestris pv.campestris. Essential oil extracted from S. rutilans was partiallyactive against Alternaria sp. and Botrytis sp. and totally active(100% inhibition) against Sclerotinia sp. and both bacteria; essen-tial oil extracted from S. munzii totally inhibited the growth of F.semitectum and R. solani; essential oil extracted from S. greggii in-hibited partially Botrytis sp. and totally Alternaria sp., Sclerotiniasp. and R. solani. Essential oils extracted from S. africana, S. icte-rina and S. mellifera did not inhibit or only partially inhibitedsome fungi. Chemical analyses of these six essential oils showedthat the main common components of S. rutilans, S. munzii and S.greggii are cis and trans thujones, camphor, d-cadinene and geran-iol. Assays on phytopathogenic fungi and bacteria with thesechemical compounds, alone or in combination, are in progress.

INFLUENCE OF A CRUDE POLYSACCHARIDIC EXTRACTFROM LENTINULA EDODES ON PATULIN SYNTHESIS BYPENICILLIUM EXPANSUM AND ON THE ACTIVITY OFTWO BIOCONTROL YEASTS. S. Zjalic1, R. Castoria2, M. Re-verberi1, A. Ricelli3, V. Tolaini1, A.A. Fabbri1 and C. Fanelli1.1Dipartimento di Biologia Vegetale, Università degli Studi “LaSapienza”, Largo Cristina di Svezia 24, 00165 Roma, Italy. 2Dipar-timento di Scienze Animali, Vegetali e dell’Ambiente, Universitàdel Molise, Via De Santis, 86100 Campobasso, Italy. 3Istituto diScienze delle Produzioni Alimentari del CNR, Via Amendola122/O, 70126 Bari, Italy. E-mail: [email protected]

The basidiomycetous edible fungus Lentinula edodes is verypopular in Asia for its nutritional and medical properties. It pro-duces lentinans, which are b-glucans displaying antioxidant, im-muno-stimulating and anticancer effects. These polysaccharideshave been reported to decrease the synthesis of mycotoxins byAspergillus and Penicillium spp, possibly through the lentinan-mediated stimulation of the antioxidant system of the toxigenicfungi. Wounds of stored apples are the main sites of penetrationof Penicillium expansum, which synthesizes patulin in rottingfruits. Wounding of fruit tissues generates the reactive oxygenspecies superoxide anion (O2) and hydrogen peroxide (H2O2),which can cause oxidative stress to the yeasts used as biocontrolagents of postharvest diseases of fruits, thus hindering their time-ly colonization of wounds and their protection of apples fromfungal pathogens. In this preliminary work, we report that thecrude lentinan extracts from L. edodes strain CF23 caused an evi-dent decrease in in vitro patulin synthesis by P. expansum and, inlab-scale experiments, enhanced the antagonistic activity of thebiocontrol yeasts Cryptococcus laurentii LS28 and Rhodotorulaglutinis LS11 against the same fungus on apple fruits. The influ-ence of crude lentinans on ROS production by apple tissues andon the resistance of the biocontrol yeasts to oxidative stress is un-der assessment.

ACQUISITION OF GRAPEVINE LEAFROLL ASSOCIATEDVIRUS 1 BY PLANOCOCCUS FICUS. A. Zorloni, M. MolinoLova, S. Prati and G. Belli. Istituto di Patologia Vegetale, Univer-sità degli Studi, Via Celoria 2, 20133 Milano, Italy. E-mail: anna. [email protected]



It is known that the mealybug Planococcus ficus Signoret cantransmit the vitiviruses GVA (Grapevine virus A) and GVB(Grapevine virus B), and the ampelovirus GLRaV-3 (Grapevineleafroll-associated virus 3). Whether this mealybug species couldtransmit also GLRaV-1 was investigated in the present work.Therefore, individuals of Pl. ficus were allowed to feed onGLRaV-1 infected vines (singularly or in mixed infection withGLRaV-3 and GVA) for different acquisition access periods(AAP): 1h, 2h, 4h, 6h, 1day, 4dd, 7dd, 10dd, 15dd, 21dd, or forundetermined periods. 902 insects, collected from infected plants

after the acquisition access period, were analysed singularly or ingroups of 2 to 10 individuals; 540 samples were tested by DAS-ELISA using a GLRaV-1 specific polyclonal antiserum. Positiveresults were obtained in 61 cases; GLRaV-1 was detected in 57single insects and in samples made up of 3, 5, 7 and 10 individu-als. In our experiments, the minimum AAP required to acquireGLRaV-1 was 2 h, but the virus was detected in insects also after21 days feeding period. These results show that Pl. ficus can ac-quire GLRaV-1. Further work is in progress in order to test itscapacity to transmit this virus from infected to healthy vines.



Date post:	25-Nov-2023
Category:	Documents
Upload:	independent
View:	0 times
Download:	0 times

Antifungal activity of the leaf extracts of laurel (Laurus nobilis L.), orange (Citrus sinensis...

Documents