Journal of Cellular Biochemistry 89:1056–1076 (2003)

1a, 25-Dihydroxy-Vitamin D3 Alters Syk ActivationThrough FcgRII in Monocytic THP-1 Cells

Jose Agramonte-Hevia,1 Claudia Hallal,1 Claudia Garay-Canales,1 Christian Guerra-Araiza,2

Ignacio Camacho-Arroyo,2 and Enrique Ortega Soto1*1Departamento de Inmunologıa, Instituto de Investigaciones Biomedicas,Universidad Nacional Autonoma de Mexico, Mexico D. F., Mexico2Departamento de Biologıa, Facultad de Quımica, Universidad Nacional Autonoma de Mexico,Mexico D. F., Mexico

Abstract In monocytes and macrophages, activation of the tyrosine kinase Syk is an essential step in thebiochemical cascade linking aggregation of receptors for immunoglobulin G (FcgR) to initiation of effector functions. Anincrease in Syk activation during differentiation of myeloid cells by different agents has been reported. We studied theactivation state of Syk in response to FcgRII crosslinking inmonocytic cells before and after in vitro differentiationwith 1a,25-dihydroxy-vitaminD3.We showhere thatwhile in undifferentiated THP-1 cells clustering of FcgRII induces significantphosphorylation and activation of Syk, in THP-1 cells differentiated in vitro by 1a, 25-dihydroxy-vitamin D3, FcgRIIcrosslinking induced a decrease in Syk activity. In vitro differentiation did not induce changes in the expression of FcgRIIisoforms. Theobservedeffect on Syk activation thoughFcgRII could bemediatedbydifferentiation-inducedchanges in theexpression and basal activation level of Syk, as well as changes in the association of Syk with the tyrosine phosphataseSHP-1. These results suggest that the biochemical signaling pathways induced by FcgRII could be dependent on thedifferentiation state of the cell. J. Cell. Biochem. 89: 1056–1076, 2003. � 2003 Wiley-Liss, Inc.

Key words: mononuclear phagocytes; IgG receptors; tyrosine kinase; monocyte differentiation

Macrophages and their blood precursors,monocytes, play important roles in host defenseand homeostasis. Monocytes and macrophagesexpress receptors for the Fc portion of immu-noglobulin G (FcgR), which are members ofthe immunoglobulin superfamily [Hunkapillarand Hood, 1989]. Three classes of biochemicallydistinct FcgRs have been described: FcgRI,FcgRII, and FcgRIII [Ravetch and Kinet, 1991;Unkeless et al., 1992], and each class includesseveral isoforms. FcgRI is a high-affinity recep-tor that bindsmonomeric IgG,while FcgRII andFcgRIII are low-affinity receptors that bind

multimeric immune complexes [Ravetch andKinet, 1991; Cassel et al., 1993; Daeron, 1997].

In humans, both FcgRI and FcgRII are eachencoded by three genes (A, B, and C) located atchromosome 1 (q21–23), whereas two genes (Aand B) code for FcgRIII [Ravetch and Kinet,1991; Cassel et al., 1993; Daeron, 1997]. FcgRIexpressed in the membrane of hematopoieticcells is encoded in the geneAand is a transmem-brane receptor with three extracellular Ig-likedomains. Genes B and C encode secreted formsof the receptors with only two Ig-like domains[Ernst et al., 1992].

FcgRII A, B, and C genes encode transmem-brane receptors bearing two highly homologousextracellular domains, but the receptors en-coded by FcgRIIB differ considerably in theircytoplasmic domains from those encoded byFcgRIIA and FcgRIIC. FcgRIIA originates twotranscripts: FcgRIIa1 (which encodes a trans-membrane receptor) and FcgRIIa2 (which lacksthe transmembrane exon and thus generatesoluble IgG-binding factor [Rappaport et al.,1993]. FcgRIIB generates three transcripts(FcgRIIb1, FcgRIIb2, and FcgRIIb3) [Cassel

� 2003 Wiley-Liss, Inc.

Grant sponsor: CONACYT; Grant number: 31783N; Grantsponsor: DGAPA; Grant number: IN213701.

*Correspondence to: Enrique Ortega Soto, PhD, Departa-mento de Inmunologıa, Instituto de Investigaciones Bio-medicas, U.N.A.M, Apartado Postal 70228, CiudadUniversitaria, D.F., 04510 Mexico. E-mail: ortsoto@servi-dor.unam.mx

Received 24 July 2002; Accepted 28 March 2003

DOI 10.1002/jcb.10575

et al., 1993]. FcgRIIC produces four differenttranscripts (FcgRIIc1-4) in NK cells; of these,FcgRIIc1 is the form expressed inmonocytes andmacrophages [Mates et al., 1998]. The cyto-plasmic tails of FcgRIIA1 and FcgRIIC1 areidentical and contain a sequence motif, termedthe immunoreceptor–tyrosine-based activationmotif (ITAM; consensus sequence: D/EX2YX2

LX7–12YX2L/I), foundinseveralsignalingchainsof antigen receptors and immunoglobulin recep-tors [Reth, 1989], including the g-chains asso-ciated with FcgRI and FcgRIIIA [Park et al.,1993; Indik et al., 1994]. FcgRIIB1 andFcgRIIB2

are identical except for a 19-amino-acid insert inthe cytoplasmic tail of FcgR IIB1. Both receptorshave a 13-mer containing the consensus I/VxYxxL/V sequence found in many inhibitoryreceptors known as immunoreceptor tyrosine-based inhibition motif (ITIM) [Daeron et al.,1995; Cambier, 1997]. Coaggregation of theITIM-containing FcgRIIBmolecules with ITAMcontaining immune receptors such as the BCR,induces phosphorylation of the tyrosines withinthe ITIMmotif. Once phosphorylated, the ITIMmotifs can recruit SH2 domain-containing pro-tein phosphatases such as SHP-1 and SHP-2 aswell as the phosphatidylinositol 50-phospha-tases SHIP-1 and SHIP-2 [D’Ambrosio et al.,1995, 1996; Ono et al., 1996; Sato and Ochi,1998]. The recruitment and activation of thesephosphatases have been shown to negatively re-gulate signaling by ITAM-containing receptors.Crosslinking of FcgRs by immune complexes

or IgG-opsonized particles induces phosphory-lation of tyrosine residues within the cytop-lasmic domains of the receptors or associatedsubunits [Santana et al., 1996]. The first in-tracellular enzymes known to be activated afterFcgR crosslinking are tyrosine kinases of theSrc family [Jouvin et al., 1994]. Src kinaseactivation results in a rapid and transient phos-phorylation of the ITAMs on either the cyto-plasmic domain of FcgRIIA or the g-chainsassociated with FcgRI and FcgRIIIA [Parket al., 1993; Indik et al., 1994, 1995]. FcgRscrosslinking also results in an increase in ty-rosine phosphorylation and activation of Syk[Agarwal et al., 1993; Kiener et al., 1993]. Syk isa protein tyrosine kinase of the Syk/ZAP-70family, composed of two N-terminal Src homol-ogy domains and a C-terminal catalytic domain[Bolen and Brugge, 1997; Kiefer et al., 1998]. Inmonocytes andmacrophages, FcgR aggregationinduces Syk association with the phosphory-

lated ITAM motifs of the g-chain of the FcgRIand FcgRIIIA and of the cytoplasmic domainof FcgRIIA. Once associated, Syk becomesphosphorylated on tyrosine, is activated, andcatalyzes the phosphorylation of multiple sub-strates, including other FcgRs ITAMs anddownstream effectors [Greenberg et al., 1994;Rowley et al., 1995]. Syk activation has beenshown to be a crucial step in FcgR mediatedsignaling, since blocking Syk activation, eitherby the specific inhibitor piceatannol, or by anti-sense oligonucleotides, completely abolishesdownstream signaling stimulated throughFcgRs [Matsuda et al., 1996; Pain et al., 2000].

Syk is not only important in signaling througha variety of receptors in both lymphoid andmyeloid cells [Chan et al., 1994; Turner et al.,2000], but it has also been shown to play anessential role in the development of B cells[Cheng et al., 1995; Turner et al., 1995] and asubset of T cells [Turner et al., 1995; Mallick-Wood et al., 1996]. The role of Syk during dif-ferentiation ofmyeloid cellshasnotbeen studiedin detail. An increase in tyrosine phosphoryla-tion and catalytic activity of Syk has been ob-served during in vitro differentiation of HL-60cells into granulocytes induced by all-transretinoic acid [Qin and Yamamura, 1997].

Monocyte to macrophage differentiation is acomplex process that can follow distinct path-ways depending on the signals acting on the cell,thus producing the high degree of functionalheterogeneity of mature macrophages. Thisfunctional heterogeneity includes almost allmacrophage functions: abilityasAPC, secretion,and effector functions including the responsesmediated by FcgRs [Adams and Hamilton,1992]. Given the essential role of Syk in signal-ing through FcgRs and the possible involvementof Syk in the differentiation of cells expressingthese receptors, wewere interested in determin-ing if the differentiation along a particularmonocyte-macrophage pathway could affect theactivation of Syk in response to FcgR cross-linking. As a model system, we studied the acti-vation of Syk in response to FcgR crosslinking inthehumanmonocytic cell lineTHP-1, beforeandafter it was induced to differentiate with 1a,25-dihydroxyvitamin D3 (VD3). This metabolite ofVitamin D has multiple effects on the differ-entiation and function of hematopoietic cells invivo [Bouillon et al., 1995], and has been shownto promote the in vitro differentiation of mono-cytic cell lines into a more macrophage-like

FcgRII Signaling in Monocyte Differentiation 1057

phenotype [Choudhuri et al., 1990; Kreutz andAndreesen, 1990; Schwende et al., 1996].

We found that in undifferentiated THP-1cells, FcgRII crosslinking induces significantSyk activation. However, in THP-1 cells differ-entiated by VD3, the phosphorylation level andactivation state of Syk following FcgRII cross-linking was greatly reduced. The changes thatwe found in the expression of FcgRII isoforms donot seemtobe related to this effect.However,wefound that differentiation with VD3 induceschanges in the association of Syk with the pro-tein phosphatase SHP-1, and this can explainthe inhibition of Syk activation after FcgRIIcrosslinking.

These results demonstrate that the biochem-ical signaling pathways induced by crosslinkingof FcgRII are dependent on the differentiationstatus of the cell.

MATERIALS AND METHODS

Reagents and Antibodies

Fetal bovine serum (FBS) and Protein A-Sepharose beads were purchased from GibcoLaboratories (Grand Island, NY). The 1-a,25-dihydroxy-vitamin D3 (1a, 25-(OH) 2 VitD3),VD3 was from CALBIOCHEM (La Jolla, CA).Bovine serum albumin (BSA) was from Sigma(St. Louis, MO). 2,4,6-Trinitrobenzene sulpho-nic acid (TNBS) for sensibilization of sheeperythrocytes was from Eastman Kodak Co.Murine monoclonal anti-human FcgRI (32.2)and FcgRII (IV.3) mAbs were purified in ourlaboratory from supernatants of the correspon-ding hybridomas obtained from ATCC. Fabfragments were prepared from the purifiedantibody with Immobilized Pepsin (Pierce),following the manufacturer’s instructions.Murine monoclonal anti-human FcgRIIIA(3G8) was from Zymed (San Francisco, CA).Anti-Syk (SC-573), anti-SHP-1 (SC-287), andanti-phosphotyrosine antibodies (PY-20, SC-508, and PY-20-HRP, SC-508HRP) were fromSanta Cruz Biotechnology (Santa Cruz, CA).Goat anti-rabbit IgG F(ab)02 was from Zymed(62–6120); goat anti-mouse IgG-HRP was fromJackson Immuno Research (Amish, PA). Anti-CD11b monoclonal antibody (2LPM19c) (M0747) was from DAKO Corporation (Carpin-teria, CA). Mouse monoclonal DNP-specificantibodies 2C5 (IgG1) and 4F8 (IgG2b) used asisotype controls for cytofluorometry and as op-sonizing antibodies in the phagocytosis assay

were produced in our laboratory from culturesupernatants of the corresponding hybridomas.Goat anti-mouse IgG-FITC was from Zymed.Myelin basic protein (MBP) was kindly donatedby Dr. Janet Oliver (University of New Mexico,Albuquerque, NM). g-32P-ATP was from NewEngland Nuclear (Beverly, MA).

Reagents for RNA isolation andRT-PCRwerepurchased fromGibco-BRL, Inc. (Gaithersburg,MD) andSigmaChemical Corp. (St. Louis,MO).Taq DNA polymerase was purchased fromPerkin-Elmer (Branchburg, NJ).

Flow Cytometry

THP-1 cell suspensions (0.5� 106 cells/ml) inPBSwith 5%FBS and 0.01% sodium azide wereincubated with 10 mg/ml of one of the followingprimary murine monoclonal antibodies: anti-FcgRI (32.2), anti-FcgRII (IV.3), anti-FcgRIIIA(3G8), anti-CD11b (2LPM19c), anti-DNP IgG1

(2C5), or anti-DNP IgG2b (4F8) for 60 min at48C. After washing, cells were incubated in thedark for 90 min with 0.45 mg/ml FITC-labeledgoat anti-mouse IgG at 48C. After washing, thecells were fixed for 30 min in 0.3% paraformal-dehyde, followedby threewasheswithPBS.Thestained cells were analyzed in a FACscan cy-tometer (Becton Dickinson, San Jose, CA).

Cell Culture and In Vitro Differentiation

The monocytic cell line THP-1 was obtainedfrom the American Type Culture Collection(ATCC). The cells were cultured in RPMI-1640medium (GIBCO-BRL) supplementedwith 10%(v/v) heat-inactivated FBS, 1mMMEMSodiumpyruvate solution, 2 mM MEM non-essentialamino acids solution, 0.1 mM of L-glutamine,100 U/ml penicillin, and 100 mg/ml streptomy-cin. Cultures were maintained in a humidifiedatmosphere with 5% CO2 at 378C. Differentia-tion was induced by culturing THP-1 cells(3� 106 cells/ml) in the presence of 100 nM of1a,25-dihydroxy-vitamin D3 for 72 h. Cell dif-ferentiation was confirmed by changes in cellmorphology, as well as increases in membraneexpression of complement receptor type3 (CR3).Microscopic phase-contrast images of undiffer-entiated and VD3-differentiated cells were ob-tained in an Axiovert 25 (Carl Zeiss) invertedmicroscope attached to a photographic camera.

Cell Stimulation and Immunoprecipitation

THP-1 cell suspensions (1� 107 cells/ml)weremaintained in serum-free RPMI-1640 medium

1058 Agramonte-Hevia et al.

for 10minon ice, previous to the incubationwith10 mg/ml of Fab fragments of mouse anti-FcgRI(32.2) or anti-FcgRII (IV.3) mAb, for 10 min onice. The cell suspension was then centrifuged at15,000g for 1 min at 48C, and the supernatantwas discarded. To induce FcgR aggregation, thecells were resuspended in 1.0 ml of freshmedium (without FBS) containing 10 mg/ml ofF(ab)02 fragments of rabbit anti-mouse IgG, forthe indicated times at 378C. Stimulation wasstopped by addition of 500 ml of ice-cold TBS(10mMTris-HCl, 100mMNaCl, pH7.4) and thecells were pelleted by centrifugation at 48C. Thesupernatant was discarded and the cells werelysed in 1 ml of lysis buffer (1% Triton X-100,50 mM Tris-HCl (pH 7.4), 150 mM NaCl, 5 mMEDTA, 1 mM Na3VO4, 1 mM phenyl-methylsulfonyl fluoride, 10 mM NaF and 1 mg/ml ofPepstatinA, Leupeptin andAprotinin) and kepton ice for 15 min. Lysates were clarified by cen-trifugation at 15,000g for 15min at 48C. Proteinconcentration in cell lysates was determined bythe DC Protein Assay (Bio-Rad, Hercules, CA),following the manufacturer’s instructions. Forimmunoprecipitation, the clarified lysates wereincubated for 3 h at 48C with anti-Syk antibo-diespreboundtoproteinA-Sepharosebeads. Im-munoprecipitateswerewashed three timeswithwashing buffer (of identical composition as lysisbuffer but with 0.1% Triton X-100), and usedfor in vitro kinase assays, or they were boiled inLaemmli sample buffer and separated on 10%SDS–PAGE for immunoblotting.Where indicated, cells were incubated before

stimulation with 100 mMpervanadate for 5 minat 378C. Pervanadate was generated by mixing1 ml of 20 mMNa3VO4 with 330 ml of 30% H2O2

and incubating for 5 min at room temperature,obtaining a solution of 6 mM pervanadate.

Immunoblotting

Immunoprecipitates or whole cell lysateswere separated by 10% SDS–PAGE and trans-ferred to nitrocellulose membranes. Membra-nes were blocked with 1% BSA and 3% non-fatdry milk in low-salt Tween-20-Tris-bufferedsaline (T-TBS) (10 mM Tris-HCl [pH 7.4], 100mM NaCl, 0.1% Tween-20) overnight at 48C.This was followed by incubation with primaryantibody (anti-phosphotyrosine (PY-20), anti-Syk or anti-SHP-1) for 90 min at room tem-perature. After washing, the membranes wereincubated with a secondary antibody conju-gated tohorseradishperoxidase inT-TBS for 1h

at room temperature. For chemiluminiscent de-tection, blots were treated with Super SignalECL kit (Pierce) according to the manufac-turer’s instructions, and exposed to X-ray films.Digitalized images of the developed films usedto capture the chemiluminiscent signals wereobtained with the Gel-Doc 2000 System (Bio-Rad) and analyzed with the Bio-Rad QuantityOne software. Where indicated, membraneswere stripped and reblotted with a differentprimary antibody. For stripping, membraneswere incubated in 0.1 M glycine (pH 2.5) for 1 hat 608C. After washing, the membranes wereblocked and incubated with primary and sec-ondary antibodies and processed as describedabove.

In Vitro Kinase Assays

The washed immunoprecipitates obtained asdescribed above, were incubated in 50 ml ofkinase buffer (50 mM HEPES-sodium hydro-xide pH 8.0, 10 mM Na3VO4, 50 mM mangane-siumacetate, 150mMNaCl, 10 mCi [g-32P]-ATP,and 2.5 mg/ml MBP) for 10 min at 378C. Afterwashing three times with 1 ml of kinase buffer(without [g-32P]-ATP), the immunoprecipitateswere boiled in SDS–PAGE sample buffer andresolved on 12.5% SDS–PAGE gels. The driedgels were exposed at �708C on X-ray films.

Phagocytosis Assay

Sheep RBC were kept at 48C in Alsever’ssolution for a maximum of 4 weeks until used.They were washed in DGVBþ and derivatizedwith 2,4,6-trinitrobenzene sulphonic acid, so-diumsalt (TNBS) by incubating 1.0ml of packedSRBC with 12.44 mg of TNBS in 7 ml of boratebuffer with gentle shaking and protected fromlight for 10 min at room temperature. Thesensitized RBC were washed two times withDGVBþ and once with RPMI medium withoutFBS. Fifty microliters of a 2% suspension ofsensitizedRBC inRPMIwere added to eachwellof a 96-well V-bottom plate containing 100 ml ofserial 1:2 dilutions of anti-DNP 4F8 antibody.The plates were incubated at room temperaturefor 90 min. The hemagglutination titer wasdetermined as the lowest concentration of anti-DNP monoclonal 4F8 antibody that producedvisibleRBCagglutination.Opsonization ofRBCwith anti-DNP IgG was carried out by incubat-ing a 1% suspension of sensitized RBC in RPMIwith a sub-hemagglutination dilution of anti-DNP IgG at room temperature for 60 min. The

FcgRII Signaling in Monocyte Differentiation 1059

unbound antibodies were removed by centrifu-gation. For the phagocytosis assay, 320 ml of asuspension of THP-1 cells (1� 106/ml) was in-cubated with 60 ml of anti-DNP opsonized ornon-opsonized RBC for 2 h at 378C in a 5% CO2

humidified incubator. The cells were then was-hed three times with PBS to remove unboundRBCs. Non-internalized RBCs were lysed with0.2% PBS for 30 s. Phagocytosis assays wereperformed in triplicate. RBC ingestion by THP-1 cells was examined by light microscopy by anobserver who was blind to the treatment con-ditions. The results are expressed as the ph-agocytic index (number of ingested RBC by 100cells).

RNA Isolation, Reverse Transcription(RT) and PCR

Total RNA was isolated from THP-1 cells bythe single-step method based on guanidineisothiocyanate/phenol/chloroform extractionusing TRIzol (Gibco-BRL, Inc.) [Chomczynskiand Sacchi, 1987]. RNA concentration was de-termined by absorbance at 260 nm and its in-tegrity was verified by electrophoresis on 1.1%denaturing agarose gels in the presence of 2.2Mformaldehyde. Total RNA was reverse tran-scribed to synthesize single strand cDNA aspreviously described [Camacho-Arroyo et al.,1996]. Ten microliters of RT reaction were sub-jected to PCR in order to simultaneously am-plify FcgRI, FcgRIIA, FcgRIIB, FcgRIIC, andb-actin genes, the latter used as an internalcontrol. The sequences of the specific primersused for amplification are given in Table I. The50 ml PCR reaction included: 10 ml of previouslysynthesized cDNA and 40 ml of a mixturecontaining 20 mM Tris-HCl (pH 8.3), 50 mMKCl, 1mMMgCl2, 0.2mMof each dNTP, 0.5 mMof each primer, and 2.5 units of Taq DNA

polymerase. Negative controls without RNAand with non-retrotranscribed RNA wereincluded in all the experiments. After the initialdenaturation step at 958C for 5 min, 30 cycleswere carried out for PCR amplification. Thecycle profile for all genes amplification was:958C, 1 min; 608C, 1 min; and 728C, 1 min. Afinal extension cyclewasperformedat 728C for 5min. The number of cycles performed was with-in the exponential phase of the amplificationprocess. Twenty-five microliters of PCR pro-ducts were separated on 2% agarose gels andstained with ethidium bromide. The image wascaptured under a UV transilluminator on Type665 negative film (Polaroid Co., Cambridge,MA). In each experiment, the amplification andanalysis of the products of each gene were car-ried out in parallel. The images were capturedin a Scan Jet 3C scanner (Hewlett-Packard)and the intensities of the individual bandswere quantified using a Scand Primax 600p(Colorado), and Scion Image software. To get asemi-quantitative estimation of the mRNAs foreach FcgR isoform, the intensity of the bandcorresponding to the amplification product wasnormalized to the intensity of the b-actin band.Thus, the relative expression level of each FcgRisoform is expressed as the ratio of intensities ofits corresponding band to b-actin band.

Statistical Analysis

Data were analyzed by using a one way an-alysis of variance (ANOVA) followed by a Stu-dent’s t-test. Prism 2.01 program (Graph Pad,CA) was used for calculating probability values.

RESULTS

VD3-Induced Differentiation of THP-1 Cells doesnot Alter Membrane Expression of FcgRs

In vitro treatment of THP-1 cells with theactivemetabolite of VitaminD3has been shownto induce some differentiation related changes[Kreutz and Andreesen, 1990; Schwende et al.,1996]. To determine whether VD3 treatmentmodulates the surface expression of FcgRs inTHP-1 monocytic cells, cells were incubated inRPMI-1640—10% FBS for 72 h with or without100 nM of VD3. Surface expression of CD11b/CD18 (CR3), FcgRI, FcgRII, and FcgRIII wasevaluated by cytofluorometry using mAbs 2LP-M19c, 32.2, IV.3, and 3G8 specific for CD11b,FcgRI, FcgRII, and FcgRIII, respectively. VD3

TABLE I. Sequences of FcgRI andFcgRII-Specific Primers for RT-PCR

Receptor

S, sense;AS,

antisense Sequence

FcgR I S 50TGAATACAGGGTGCCAGAGAG 30

AS 30AGAAGTAAAGCTTGCAAACCA 50

FcgR IIA S 50CACGCTGTTCTCATCCAAG 30

AS 30ATTCCCCTCTTTTTGTCATCC 50

FcgR IIB1 S 50ACAACAATGACAGCGGGGA 30

FcgR IIB2 AS 30GGTGCATGAGAAGTGAATAG 50

FcgR IIC S 50TCCATCCCACAAGCAAACCA 30

AS 30TTTATCATCGTCAGTAGGTGC 50

1060 Agramonte-Hevia et al.

treatment induced differentiation-associatedchanges, such as changes in morphology andadherence of the cells to the culture flasks, aswell as an increase in CD11b/CD18 surfaceexpression. In contrast, treatment with VD3for 72 h did not significantly alter mem-brane expression of FcgRI, FcgRII, or FcgRIII(Fig. 1).

FcgRII Crosslinking Induces Syk Phosphorylation

Activation of the tyrosine kinase Syk is anessential step in the biochemical cascade ini-tiated by FcgR crosslinking [Kiener et al., 1993;Durden and Liu, 1994]. To measure the level ofSyk phosphorylation induced after crosslinkingFcgRII in THP-1 cells, the cells were first in-cubated at 48C with saturating amounts of Fabfragments of anti-FcgRII mAb for 10 min, follo-wed by crosslinking of the cell bound fragmentswith increasing concentrations of F(ab)02 frag-ments of rabbit anti-mouse IgG at 378C. Afterthe stimulation, cells were lysed, Syk was im-munoprecipitated from equivalent amounts oftotal protein lysates with anti-Syk antibodies,and the level of tyrosine phosphorylation of Sykwas assessed by anti-phosphotyrosine immu-noblotting (Fig. 2A). To account for possibledifferences in the amount of Syk immunopreci-pitated, thesameblotwasstrippedandreprobedwith anti-Syk antibody. The results show thatFcgRII crosslinking induces a significant in-crease in the level of Syk phosphorylation. Inthe experimental conditions used, Syk phos-phorylation increases as the amount of second-ary antibody is increased, reaching amaximumat 10 mg/ml of secondary antibodies (Fig. 2A).The maximal increase in tyrosine phosphory-lated proteins after FcgRII crosslinking is seenat 3 min of stimulation as shown in Figure 2B.Using these experimental conditions, we per-formed experiments in which THP-1 cells werestimulated by crosslinking FcgRII and the levelof phosphorylation of Syk was determined byimmunoprecipitating Syk, resolving the immu-noprecipitates in SDS–PAGE, transferring theresolved proteins to nitrocellulose membranes,and sequentially blotting the membranes withanti-PY and anti-Syk antibodies. Figure 2Cshows a representative experiment and Fig-ure 2D shows the average of three independentexperiments inwhich the level of Syk phosphor-ylation for each conditionwasdeterminedas theratio of anti-PY signal to anti-Syk signal of therelevant bands.

Effect of VD3-Induced Differentiation on SykPhosphorylation Levels After FcgR Crosslinking

It has been reported that the activity of Sykcan be modulated during the differentiation ofHL-60 promyelocytic leukemia cells [Qin andYamamura, 1997]. To determine whether dif-ferentiation of THP-1 cells induced by VD3treatmenthasany effect on theamount of Syk inthe cells, we performed anti-Syk inmunoblots inlysates of cells treated with VD3 for 0, 24, 48,and 72 h. The blot was stripped and re-probedwith anti-actin antibody and the results areexpressed as the ratio of the anti-Syk to the anti-actin band for each sample. The results showeda time-dependent increase in Syk levels inTHP-1 cells treated with 100 nM VD3 (Fig. 3).

To determine whether differentiation affectsSyk activation after FcgRII crosslinking, wecompared the level of Syk phosphorylation in-duced through FcgRII in THP-1 cells treated ornot with VD3 (100 nM) for 72 h. Both non-treated and VD3-treated THP-1 cells were sti-mulated through FcgRII as described above.After stimulation, cells were lysed and the le-vels of Syk phosphorylation were comparedin anti-Syk immunoprecipitates. In untreatedcells, FcgRII crosslinking induced a significantincrease in phosphorylation of Syk (Fig. 4A,lanes 1 and 2). VD3 treatment by itself inducedan increase in the basal level of Syk phosphor-ylation (Fig. 4A, lane 3). Surprisingly, in VD3treated cells the level of Syk phosphorylationafter FcgRII crosslinking was significantlylower than that observed in unstimulated VD3-treated cells (Fig. 4A, compare lanes 3 and 4).The lower panel of Figure 4A shows the resultsof three independent experiments performed ondifferent batches of THP-1 cells. The level of Sykactivation induced by FcgRII crosslinking inVD3-treated and untreated cells was also as-sessed by determining the in vitro kinase acti-vityof immunoprecipitatedSykonanexogenoussubstrate (MBP). In untreated cells, FcgRIIcrosslinking induced an increase in Syk activity(Fig. 4B, lane 2). Similar to what was observedin the level of Syk phosphorylation, VD3 treat-ment increased the basal level of Syk activity,and this basal level of activity decreased afterFcgRII crosslinking (Fig. 4B compare lanes 3and 4). Thus, while in undifferentiated THP-1cells FcgRII crosslinking induces Syk phos-phorylation and activation, after differentia-tion induced by VD3 the response to FcgRII

FcgRII Signaling in Monocyte Differentiation 1061

Fig. 1. Effect of VD3-induced differentiation on the morphol-ogy and the surface expression of FcgRs and CD11b/CD18receptors in THP-1 cells. A: THP-1 cells (5� 105/ml) wereincubated in plastic culture flasks with or without 100 nM VD3for 72 h. Microscopic phase-contrast images of the cells in theculture bottles were obtained in an Axiovert 25 (Carl Zeiss)invertedmicroscope attached to a photographic camera.B,C,D,E: Untreated or VD3-treated (100 nM, 72 h) THP-1 cells(0.5� 106) in 0.5 ml of PBS; 5% FBS; 0.1% NaN3 were incubat-ed for 60 min at 48C with 10 mg of mAbs 32.2 (anti-FcgRI), IV.3(anti-FcgRII), 3G8 (anti-FcgRIIIA) or 2LPM19c (anti-CD11b) or

the respective isotype controls (IgG1 for 2LPM19c, 32.2, 3G8and IgG2b for IV.3). After washing, the cells were stained for30 min at 48C with FITC-anti-mouse IgG. The stained cells werewashed, fixed in paraformaldehyde and examined by cyto-fluorometry in a FACScan. Left column: undifferentiated THP-1cells. Right column: THP-1 cells treated with VD3. The darkertraces are the fluorescence distributions of cells stained with thespecific antibodies. Similar results have been observed innumerous experiments performed during the course of thestudies reported here.

1062 Agramonte-Hevia et al.

crosslinking is different, decreasing both thephosphorylation in tyrosine residues and thekinase activity of Syk. To determine if this effectwas also observed after crosslinking FcgRI, weperformed similar experiments inducing FcgRI

crosslinking with anti-FcgRI Fab fragmentsand secondary antibodies.As expected, inundif-ferentiated THP-1 cells, FcgRI crosslinking in-duces Syk phosphorylation and activation(Fig. 5A). VD3 treatment by itself increased

Fig. 2. Tyrosine phosphorylation of Syk induced by FcgRIIcrosslinking. A: THP-1 cells (1� 107 in 1.0 ml) were incubatedwith 10 mg of Fab fragments of mAb IV.3 at 48C for 10 min,centrifuged and resuspended in 1.0 ml RPMI containing theindicated amounts of F(ab)02 fragments of rabbit anti-mouse IgGfor 3minat 378C. Stimulationwashaltedby the additionof 500mlof ice-cold TBS to each tube, the tubes were centrifuged and thepelleted cells were lysed in lysis buffer. Equivalent amounts oftotal protein from each lysate were used for imunoprecipitationswith anti-Syk antibodies bound to protein A-Sepharose beads toimmunoprecipitate Syk. After washing, the immunoprecipitateswere boiled in Laemmli sample buffer and resolved by SDS–PAGE and transferred to nitrocellulosemembranes. The blot wasdeveloped with anti-phosphotyrosine (anti-PY) antibodies asdescribed in Materials and Methods. The same membrane wasacid-stripped and reprobed with anti-Syk polyclonal antibodies.B: THP-1 cells (1� 107 in 1.0 ml) were incubated with 10 mg ofFab fragments ofmAb IV.3 at 48C for 10min.After centrifugation,the cells were resuspended in 1.0 ml RPMI containing 10 mg ofF(ab)02 fragments of rabbit anti-mouse IgG and incubated at 378C

for the indicated times. The cells were lysed and the phosphory-lated proteins were immunoprecipitated from equivalentamounts of total protein, and resolved by SDS–PAGE andtransferred to nitrocellulosemembranes. The blotwas developedwith anti-phosphotyrosine antibody conjugated to HRP andchemiluminiscent detection. C: THP-1 (1 X 107 in 1.0 ml) cellswere incubated for 10 min at 48Cwith RPMI alone or with 10 mgof Fab fragments of mAb IV.3. After centrifugation, the cells wereincubated at 378C for 3 min with 10 mg of F(ab)02 fragments ofanti-mouse IgG in 1.0 ml of RPMI medium. Cells were lysed andSyk was immunoprecipitated with anti-Syk antibodies bound toProtein A-Sepharose beads. Immunoprecipitates were resolvedas in A, and the blotwas sequentially developedwith anti-PY andanti-Syk polyclonal antibodies. D: The phosphorylation level ofSyk was calculated as the ratio of the densitometric intensities ofthe anti-PY signal to the anti-Syk signal of the respective bands inthree independent experiments as shown in C. Results are themean� SEM, n¼ 3. *P< 0.05 compared with unstimulated cells(lane 1).

FcgRII Signaling in Monocyte Differentiation 1063

the basal level of Syk phosphorylation, but cros-slinking of FcgRI in VD3 treated cells was stillable to cause an increase in Syk phosphoryla-tion (Fig. 5B). Thus, VD3 induces an increase inboth total level and basal phosphorylation stateof Syk, and the cells’ response in terms of Sykactivation induced by FcgRI or FcgRII cross-linking is differently affected by differentiation.

Effect of VD3 Treatment on FcgR-MediatedPhagocytosis in THP-1 Cells

To determine if VD3 differentiation affects anFcgR-mediated function, we examined the pha-gocytosis of IgGopsonized erythrocytes byTHP-1 cells after VD3 treatment for 0, 24, 48, and72 h. VD3 treatment for 48 and 72 h decreasedTHP-1 phagocytosis in a time-dependent man-ner reaching an inhibition of about 35% after

72 h (Fig. 6). VD3 treatment for 24 h did notresult in any significant decrease in phagocy-tosis (0 vs. 24 h).

Pervanadate Treatment RestoresSyk Phosphorylation Induced by FcgRII

Crosslinking in VD3-Treated Cells

To determine if the decrease in the phosphor-ylation state of Syk induced by FcgRII cross-linking in VD3-differentiated cells is mediatedby a protein-tyrosine phosphatase activity in-duced by FcgRII crosslinking, we examined ifthis effect could be prevented by a general phos-phatase inhibitor (sodium pervanadate). VD3treated cells were incubated in the presence ofsodium pervanadate for 5 min before stimula-tion by FcgRII crosslinking as above. After sti-mulation of VD3 treated or untreated cells, Syk

Fig. 2. (Continued )

1064 Agramonte-Hevia et al.

phosphorylation was analyzed by anti-PY/anti-Syk immunoblotting as described above. InVD3-treated cells, pretreatment with the phos-phatase inhibitor prevented the previouslyobserved decrease in Syk phosphorylation in-duced by FcgRII crosslinking (Fig. 7A comparelanes 3 and 5). These results suggest that inVD3-treated cells (but not in undifferentiatedTHP-1 cells) a protein tyrosine phosphatase isinvolved in regulation of the Syk phosphoryla-tion level after FcgRII crosslinking.

Interaction Between Syk and SHP-1 isModulated by VD3

SHP-1 is a protein tyrosine phosphatase,which has been shown to interact directly withZAP-70 in T cell lines and in heterologous ex-pression systems. Based on this, it has been

suggested that SHP-1 is involved in the negativeregulation of the catalytic activity of ZAP-70[Plas et al., 1996]. The physical associationof SHP-1 and Syk has also been reported, andit has been shown that Syk is a substrate forSHP-1 [Dustin et al., 1999]. To determine if VD3treatment modulates SHP-1 expression, we an-alyzed by immunoblotting the levels of SHP-1 incells treated with VD3 for different times. Theresults showed that VD3 treatment did notsignificantly affect the expression of SHP-1(Fig. 7B). In order to assess the possible asso-ciation of SHP-1 with Syk in THP-1 cells and ifthis association could be modulated by VD3treatment, we determined by immunoblottingthe presence of SHP-1 in anti-Syk immunopre-cipitates from VD3 treated and untreated cellsbefore and after FcgRII crosslinking. To obtain a

Fig. 3. Effect of VD3 on the expression of Syk in THP-1 cells.A:THP-1 cells (5� 105/ml) were incubated with 100 nM VD3 inRPMI-10% FBS for the indicated times. Cells werewashed, lysedin lysis buffer and equivalent amounts of total protein from eachlysatewere separated by SDS–PAGE. The resolved proteinsweretransferred to nitrocellulose membranes and sequentially devel-

oped with anti-Syk and anti-actin antibodies. B: The Syk levelwas calculated as the ratio of the densitometric intensities of theanti-Syk signal to the anti-actin signal in each lane in threeindependent experiments. Results are expressed asmean� SEM,n¼3. *P<0.05 compared with untreated cells (0 h).

FcgRII Signaling in Monocyte Differentiation 1065

quantitative assessment of the degree of coim-munoprecipitation of SHP-1 with Syk, the ratioof the densitometric signals of SHP-1 to Syk wascalculated. In undifferentiated, non-stimulatedTHP-1 cells, a certain degree of SHP-1 coimmu-noprecipitation with Syk was observed (Fig. 7C,lane 1, ratio¼ 1.0). Upon FcgRII crosslinking,

this association was significantly reduced(Fig. 7C, lane 2). Treatment of the cells withVD3 for 72 h slightly diminished the level ofbasal association of bothmolecules (Fig. 7C, lane3, ratio¼ 0.80). However, upon FcgR II cross-linking, a significantly higher amount of SHP-1was coimmunoprecipitated with Syk (Fig. 7C,

Fig. 4. VD3 treatment of THP-1 cell prevents Syk phosphoryla-tion inducedby FcgRII crosslinking.A: Tyrosine phosphorylationof Syk in VD3-treated and untreated THP-1 cells. THP-1 cellswere left untreated (lanes 1 and 2) or were treatedwith 100 nMofVD3 for 72 h (lanes 3 and 4). Treated or untreated THP-1 cells(107/ml) were incubated in RPMI medium with 10 mg of Fabfragments ofmAb IV.3 (lanes 2 and 4) at 48C for 10min, followedby further incubation at 378C for 3 min, with 10 mg of F(ab)02fragments of rabbit anti-mouse IgG. The cells were lysed in lysisbuffer and Sykwas immunoprecipitatedwith anti-Syk antibodiesbound to Protein A-Sepharose beads from equivalent amounts ofcell lysates. The immunoprecipitates were resolved by SDS–PAGE and transferred to nitrocellulosemembranes. The blot wasdeveloped with anti-phosphotyrosine (anti-PY) antibodies asdescribed in Materials and Methods. The same membrane wasacid-stripped and reprobed with anti-Syk polyclonal antibodies.

The phosphorylation level of Syk was calculated as the ratio ofthe densitometric intensities of the anti-PY signal to the anti-Syksignal of the respective bands. The graph shows the results fromthree independent experiments. Results are expressed as mean -� SEM. n¼3; *P<0.05 compared with unstimulated anduntreated cells (lane 1) and **P<0.05 compared with unstimu-lated andVD3 treated cells (lane 3).B: VD3 treatment blocks Sykactivation induced by FcgRII crosslinking. Anti-Syk immunopre-cipitates from lysates of equivalent number of VD3 treated anduntreated cells were obtained from unstimulated or stimulatedcells as in A. The immunoprecipitates were resuspended inkinase buffer (with 0.25 Ci of g-32P-ATP), and used for in vitrokinase assays using 0.25mg/ml ofMBP as substrate. The reactionproducts were analyzed by SDS–PAGE and autoradiography.The experiment shown is representative of three independentexperiments.

1066 Agramonte-Hevia et al.

lane 4, ratio¼ 1.70). Thedegree ofSykphosphor-ylation in cells stimulated throughFcgRII seemsto inversely correlate with the level of Syk-SHP-1 association: in non-treated cells FcgRII cross-linking results in an increase in Syk phosphor-ylation (and barely detectable association withSHP-1), whereas inVD3 treated cells the level ofSyk phosphorylation is low and its associationwith SHP-1 is highest (Fig. 7D).

Modulation of FcgRII mRNA Levels byVD3 Treatment in THP-1 Cells

The above results suggest that in VD3-treated THP-1 cells, FcgRII crosslinking resultsin a decrease in the level of Syk phosphoryla-tion, and that this effect could be mediated bymodulation of the association of SHP-1 withSyk. A possible mechanism involved in this ef-fect is that VD3 treatment could induce changesin the relative expression of FcgRII isoforms,since one of the FcgRII isoforms, FcgRIIB, is anITIM-containing receptor which has beenshown to recruit SH2-containing protein tyr-osine phosphatases (SHP-1 and SHP-2) as wellas the phosphatidylinositol 50-phosphataseSHIP to the vicinity of phospho-ITAMs [Dustinet al., 1999]. Therefore, an increase in the re-lative levels of FcgRIIB versus FcgRIIA couldprovide a mechanism to recruit more SHP-1 tothe aggregates. To test this possibility, we useda semiquantitative RT-PCR to determine if VD3modifies the expression of FcgRII isoforms. Theprimers pairs used to specifically amplify cDNAfor FcgRI, FcgRIIa, FcgRIIb1, FcgRIIb2, andFcgRIIc are shown in Table I, and the results ofa single experiment as well as the graphs of the

combined results of four independent experi-ments are shown in Figure 8. A PCR product of439 bp corresponding to the FcgRIa transcript,and two PCR products of 441 and 317 bp, cor-responding to FcgRIIa1 and FcgRIIa2 tran-scripts were obtained using the FcgRI andFcgRIIA specific primers, respectively. No dif-ferences in the level of FcgRI and FcgRIIa1mRNAs were observed after VD3 treatment,while a significant decrease in the level of the317 bp band (FcgRIIa2) was observed after 48and 72 h of VD3 treatment (Fig. 8A,B).

Two PCR products were amplified with theuse of theFcgRIIb-specificprimers: aweakbandat 582 bp corresponding to FcgRIIb1 and a frag-ment of 520 bp corresponding to FcgRIIb2. How-ever, the 582 bp fragment was clearly visibleonly in one out of four independent experimentsand even in that experiment the intensity of thisband was very faint. In contrast, the 520 bpfragment (FcgRIIb2) was always clearly detec-ted. This band reproducibly showed a biphasicpattern after VD3 treatment: it decreases after24 h of treatment and becomes almost unde-tectable at 48 h. However, after 72 h FcgRIIb2expression returned to the levels observed innon-treated cells (Fig. 8C).

Analysis of FcgRIIc mRNAs by RT-PCRshowed a band corresponding to 377 bp. No sig-nificant changes in the level of expression of thisband were detected after VD3 treatment(Fig. 8D). The expression of b-actin was notmodified by VD3 treatment (Fig. 8E). The RT-PCR for the actin mRNA was included as anxinternal control and to normalize the levels ofFcgRsmRNAsamong the different experiments.

Fig. 4. (Continued )

FcgRII Signaling in Monocyte Differentiation 1067

DISCUSSION

Receptors for the Fc portion of IgG areexpressed on the surface of almost all hemato-poietic cells. Binding of antigen-antibody com-plexes or IgG-opsonized particles to thesereceptors triggers a variety of effector responses.

These include phagocytosis, production of cyto-kines and chemokines, release of cytotoxic andmicrobicidal molecules, and changes in the ex-pression of cell-surface proteins involved in cell–cell adhesion and antigen presentation [Ravetchand Kinet, 1991]. In this way, FcgRs allow thehumoral and cellular aspects of immunity to

Fig. 5. VD3 treatment of THP-1 does not block Syk phosphor-ylation induced by FcgRI crosslinking.A: THP-1 cells (1� 107 in1.0 ml) were incubated in RPMI medium alone or with 10 mg ofFab fragments ofmAb32.2, at 48C for 10min, followedby furtherincubation at 378C for 3 min, with 10 mg of F(ab)02 fragments ofrabbit anti-mouse IgG. The cells were lysed in lysis buffer andequivalent amounts of total protein fromeach lysatewere used toimmunoprecipitate Syk. The immunoprecipitates were resolvedby SDS–PAGE and transferred to nitrocellulosemembranes. Theblot was developed with anti-phosphotyrosine (anti-PY) anti-bodies as described in Materials and Methods. The samemembrane was acid-stripped and reprobed with anti-Syk

polyclonal antibodies. B: THP-1 cells were left untreated (lanes1 and 2) or were treatedwith 100 nMof VD3 for 72 h (lanes 3 and4). Treated or untreated THP-1 cells (107/ml) were stimulated asin A. The cells were lysed in lysis buffer and Syk wasimmunoprecipitated with anti-Syk antibodies bound to ProteinA-Sepharose beads from equivalent amounts of cell lysates. Theimmunoprecipitates were resolved by SDS–PAGE and trans-ferred to nitrocellulosemembranes. The blotwas developedwithanti-phosphotyrosine (anti-PY) antibodies as described in Mate-rials and Methods. The same membrane was acid-stripped andreprobed with anti-Syk polyclonal antibodies.

1068 Agramonte-Hevia et al.

communicate and cooperate in expanding, sus-taining, and regulating immune responses.Numerous studies have identified a variety of

molecular participants and biochemical eventsinvolved in signal transduction through FcgRs[Daeron, 1997; Ravetch and Bolland, 2001].Less attention has been given to study how thebiochemical pathways initiated by individualtypes of FcgRs can be affected by the differentia-tion/activation state of the cell expressing theFcgR. The aim of this study was to determine ifthe biochemical events initiated by aggregatingFcgRII on monocytic cells are affected by thedifferentiation state of the cell.Syk is known to play a central role in

the signaling pathways activated by FcgRs[Agarwal et al., 1993; Kiener et al., 1993; Panet al., 1999]. Once activated, Syk can stimulatevarious biochemical pathways involved in thecell’s response.Because of its central role,wede-cided to study the effect of cell differentiation onsignal transductionbyFcgRII by focusing on thelevel of phosphorylation and activation of Sykafter aggregation of FcgRII in a monocytic hu-man cell line that can be differentiated in vitro.The metabolite 1a,25-dihidroxy-vitamin D3(VD3) has been shown to promote differentia-tion of monocytic cell lines towards a macro-phage-like phenotype [Choudhuri et al., 1990;Kreutz and Andreesen, 1990]. Treatment ofTHP-1 cells for 72 h with VD3 induces several

differentiation-related changes, such as anincrease in CD14 and CD11b/CD18 (CR3) ex-pression, and an increased adherence to plasticsurfaces. We showed here that in vitro treat-ment of THP-1 cells with VD3 also induces atime-dependent increase in Syk levels (Fig. 3A).The basal (unstimulated) level of tyrosinephosphorylation of Syk was also increased afterVD3 treatment. This results from a two to threefold increase in the amount of immunoreactivephosphotyrosine on Syk, as determined by com-paring the ratio of the anti-phosphotyrosinesignal with the anti-Syk signals in Syk immu-noprecipitated from cells before and after treat-ment with VD3 for 72 h (Fig. 4A). Thus, duringVD3 induced differentiation of THP-1 cells,along with an increase in the total amount ofSyk, there is a definite increase in the basalphosphorylation of Syk.

The increase in the levels of tyrosine phos-phorylation induced by VD3 correlate with anincrease in the catalytic activity of Syk againstan exogenous substrate in in vitro kinase assays(Fig. 4B, lane 3). It is interesting that a similarincrease in tyrosine phosphorylation and cata-lytic activity of Syk has also been reportedduring differentiation of HL-60 promyelociticcells into granulocytes [Qin and Yamamura,1997]. Syk has different tyrosines which can bephosphorylated/dephosphorylated and some ofthese have been implicated in regulation of itscatalytic activity. It is also known that VD3 ac-tivates a variety of proteinswithkinaseactivity,such as protein kinase C, Raf, and mitogen-activated protein (MAP) kinases [Kharbandaet al., 1994; Marcinkowaska et al., 1997;Gniadecki, 1998], involved in thedifferentiationprocess and that can potentially phosphorylateSyk tyrosine residues. At this time, themechan-ism and functional significance of the increasein tyrosine phosphorylation and activity of Sykinduced by differentiation (by VD3 in THP-1cells, by retinoic acid in HL-60 cells) is un-known, and also if other differentiation indu-cing agents have similar effect.

As has been reported, in undifferentiatedTHP-1 cells, FcgRII crosslinking induced adose-dependent increase in the level of Syktyrosinephosphorylation. Surprisingly, inVD3-treated cells FcgRII crosslinking not only failedto induce an increase in Syk phosphorylation,but it actually induced a decrease in Sykphosphorylation to levels lower than thoseobserved in unstimulated cells. As a read out

Fig. 6. VD3 treatment decrease FcgR-mediated phagocytosis inTHP-1 cells. Sheep RBC were opsonized with anti-DNP IgG asdescribed in Materials andMethods. For the phagocytosis assay,320 ml of THP-1 cells suspension (1� 106/ml) were incubatedwith 60 ml of a 2% suspension of opsonized (empty bars) or non-opsonized (gray bars) RBC for 2 h at 378C in a 5%carbon dioxidehumidified incubator. The cells were then washed three timeswith PBS to removeunboundRBCs.Non-internalizedRBCswerelysed with 0.2% PBS for 30 s. RBC ingestion by THP-1 cells wasexamined by light microscopy by an observer who was blind totreatment conditions. All assayswere performed in triplicate. Theresults are expressed as the phagocytic index (number of ingestedRBC by 100 cells). Results are expressed as mean� SD. n¼ 3,*P< 0.05 compared with the untreated cells (0 h).

FcgRII Signaling in Monocyte Differentiation 1069

assay to evaluate the effect of the decrease inSyk phosphorylation on an FcgR mediatedsignal, we determined if VD3 treatment wouldinhibit FcgR-mediated phagocytosis of IgG-coated SRBC. The phagocytosis of IgG-coatedRBC decreased only about 35% with VD3

treatment (Fig. 6). However, it should be notedthat during IgG-mediated phagocytosis Sykactivation induced by FcgRI is still taking place.As we show in Figure 5, Syk phosphorylationinduced by FcgRI is not affected by the VD3treatment, and thus can partially compensate

Fig. 7. Syk phosphorylation level after FcgRII crosslinkingcould bemodulated by a protein tyrosine phosphatase.A: THP-1cells were left untreated (lanes 1 and 2) or were treated with 100nM of VD3 for 72 h (lanes 3–5). Just before stimulation a sampleof VD3 treated cells (lane 5) was incubated with 100 mM sodiumpervanadate for 5 min at 378C. The cells were then stimulatedthrough FcgRII or left unstimulated as described in legend toFigure 2C. Syk was immunoprecipitated from equivalentamounts of cell lysates and the immunoprecipitates wereseparated on SDS–PAGE and transferred to nitrocellulosemembranes. The blots were sequentially probed with anti-PYand anti-Syk antibodies. The graph show the results of threeindependent experiments expressed as the mean� SEM. n¼3,*P<0.05 compared with FcgRII stimulated and VD3 treated cell(lane 3). B: Effect of VD3 on expression of SHP-1. THP-1 cells(5�105/ml) were incubated with 100 nM VD3 for the indicatedtimes. Lysates were prepared and equivalent amounts of totalprotein from each lysate were separated by SDS–PAGE. Theresolved proteins were transferred to nitrocellulose membranesand sequentially developed with anti-SHP-1 and anti-actin

antibodies. The graph shows the average of three independentexperiments.C: Coimmunoprecipitationof SHP-1andSyk.VD3-treated (lanes 3 and 4) or untreated (lanes 1 and 2) THP-1 cellswere stimulated through FcgRII as described in legend toFigure 2C. Anti-Syk immunoprecipitates were prepared fromequivalent amounts of cell lysates. The immunoprecipitatedproteins were separated on SDS–PAGE, transferred to nitrocel-lulose and probed with anti-Syk and anti-SHP-1 antibodies. Thegraph shows themean� SEM of three independent experiments;*P< 0.05 compared with untreated and unstimulated cells(lane 1) and **P<0.05 compared with stimulated, untreatedcells (lane 2).D: Syk-SHP-1 association inversely correlates withthe level of Syk phosphorylation. VD3-treated (lanes 3) oruntreated (lanes 1 and 2) THP-1 cells were stimulated throughFcgRII as described in legend to Figure 2. Syk was immunopre-cipitated from the cell lysates and the immunoprecipitates wereresolved by SDS–PAGE. The resolved proteins were transferredto nitrocellulose membranes which were sequentially probedwith anti-PY, anti-Syk, and anti-SHP-1 antibodies. Results arerepresentative of three independent experiments.

1070 Agramonte-Hevia et al.

the deficient Syk activation induced by FcgRIIin cells differentiated by VD3.The possibility that this decrease in Syk

phosphorylation is mediated by the FcgRIIcrosslinking-induced activation of a proteinphosphatase was suggested by the fact that thiseffect was eliminated by previous treatment ofthe cells with sodium pervanadate, a generalphosphatase inhibitor. This suggests that aphosphatase activity, which is affected byFcgRII crosslinking, is involved in regulatingthe state of Syk phosphorylation. Several linesof evidence have pointed to the protein tyrosinephosphatase SHP-1 as a negative regulator ofsignaling through ITAM-containing immunor-eceptors by acting on tyrosine kinases of theSyk/ZAP-70 family. SHP-1 has been implicatedin the negative regulation of the activity of ZAP-70 in T lymphocytes [Plas et al., 1996]. It hasalso been shown that in B cells there is aphysical association of SHP-1with Syk and thatSyk is a substrate for SHP-1 [Dustin et al.,1999]. Inme/memice, SHP-1was proposed to bea critical molecule used by FcgRIIB for down-regulationofBCRsignaling [Dustinetal., 1999].In vitro studieshave shown thatSHP-1 canbindto the ITIM motif of FcgRIIB [Leosurne et al.,2001]. Our results showed that in THP-1 cells,SHP-1 can be shown to coimmunoprecipitatewith Syk, and that the degree of coimmunopre-

cipitation is affected by the differentiation stateof the cell and by FcgRII crosslinking. It is im-portant to note that SHP-1 expression level wasnot altered by treatment with VD3 (Fig. 7B). Inresting, undifferentiated cells, a small but defi-nite amount of SHP-1 is reproducibly found inanti-Syk immunoprecipitates. Since in theseconditions Syk is not phosphorylated to detect-able levels, the molecular basis for this consti-tutive association in THP-1 cells is unknown. Itis possible that SHP-1 interacts with Syk by amechanism independent of the binding of SH2domains of SHP-1 to phosphorylated tyrosineresidues in Syk. In this respect, it has beenreported that the functional interaction bet-ween SHP-1 and JAK2 is independent of tyro-sine phosphorylation of JAK2, and does notrequire the functional SH2 domains of SHP-1[Jiao et al., 1996]. In U937 cells the constitutiveassociation of SHP-1 and Lyn has been reportedto be dependent on Lyn SH3 domain [Yoshidaet al., 1999; Somani et al., 2001].

The constitutive association of Syk and SHP-1 in undifferentiated cells is lost upon FcgRIIcrosslinking, concomitant with the increase inSyk tyrosine phosphorylation. These results arein contrast with reports in B cells showing thatBCR engagement and subsequent Syk tyrosinephosphorylation does not affect the associationof Syk and SHP-1 [Dustin et al., 1999].

Fig. 7. (Continued )

FcgRII Signaling in Monocyte Differentiation 1071

Differentiation for 72 h induced by VD3slightlydiminished the level of basal associationof Syk and SHP-1 (Fig. 7C). In contrast to un-differentiated cells, FcgRII crosslinking in-duced a significant increase in the amount ofSHP-1 that coimmunoprecipitateswithSyk anda significant decrease in the level of Syk phos-phorylation (Fig. 7C,D). Taken together, theseobservations suggest that in VD3 treatedmono-cytic cells, Syk could be negatively regulatedby SHP-1 mediated dephosphorylation afterFcgRII crosslinking.

A possible mechanism by which differentia-tion by VD3 might modify the physical and

functional interaction between Syk and SHP-1after FcgRII crosslinking with respect to undif-ferentiated cells, is that VD3 treatment altersthe relative expression of FcgRII isoforms,inducing an increase in the expression ofFcgRIIB, thus promoting SHP-1 recruitment tothe FcgRII aggregates by binding to the FcgRIIBITIMs.SHP-1hasbeenshown tobind toFcgRIIBphosphorylated ITIMs [D’Ambrosio et al., 1996;Sato and Ochi, 1998], and also to associate withFcgRIIBwhen it is co-aggregated with the type IFcER in bone marrow derived mast cells [Fonget al., 1996]. We observed that VD3 induced atransient decrease in FcgRIIb expression, but

Fig. 7. (Continued )

1072 Agramonte-Hevia et al.

after 72 h of VD3 treatment expression ofFcgRIIb1 and FcgRIIb2 returned to the levelobserved in non-differentiated cells (Fig. 8C).Although this does not rule out the possibilitythat in VD3-differentiated cells SHP-1 gainsaccess to thevicinityofSykdue to its recruitmentto the receptor aggregates by interacting withFcgRIIB ITIMs, it does indicate that the differ-ences in Syk-SHP-1 interactions observed bet-ween differentiated and undifferentiated cellsare regulated by factors other than differentia-tion-induced changes in expression of FcgRIIisoforms.Anotherpossibility is thatalthoughtheexpression of FcgRIIB does not change in VD3differentiated cells, the level of phosphorylationof its ITIM motif is higher, enhancing its ability

to recruit SHP-1 [Leosurne et al., 2001]. Differ-entiation-regulated changes inSHP-1 activationhave been previously reported in myeloid cells[Uesugi et al., 1999, 2000].

Our findings are consistent with a scheme inwhich, in undifferentiated resting cells, thebasal phosphorylation level of Syk is regulatedby SHP-1, which is constitutively associated toSyk in a phosphorylation independent way.FcgRII crosslinking induces dissociation ofSHP-1-Syk complexes, and causes Syk to berecruited to the phosphorylated FcgRII ITAMsand activated. Differentiation by VD3 modifiesthe interplay between Syk and SHP-1 such thatthe basal phosphorylation level of Syk increa-ses, and FcgRII crosslinking promotes both

Fig. 8. Effect of VD3 treatment of THP-1 cells on the expressionof transcripts for FcgR isoforms. RNA was isolated from THP-1cells treated for 0, 24, 48, and 72 h with VD3 and was reversetranscribed and PCR amplified with the FcgRII A, B, and Cspecific primer pairs indicated in Table I. After the PCR reaction,the products were analyzed on a 2%agarose gel containing EtBr.A: FcgR I; (B) FcgR II a1, a2 isoforms; (C) FcgR II b1, b2 isoforms;(D) FcgR II c1 isoform; and (E) b-actin. Specific bands with the

expected sizes for each primer pair were detected in each panel.PCRproductswere quantifiedbydensitometric analysis and theirexpression is presented as relative to the data of b-actin mRNAdensitometric values. The graphs (F) show the relative levels ofFcgR isoform-specific transcripts after 0, 24, 48, and 72 h of VD3treatment obtained from four independent experiments (mean -� SEM of four independent experiments; *P< 0.05 comparedwith untreated cells, 0 h).

FcgRII Signaling in Monocyte Differentiation 1073

SHP-1 activation and a decrease in the level ofSyk phosphorylation and activity. Surely, othermolecules might be participating in the differ-entiation related changes in regulation of Sykactivity; further studies are necessary to dissectthe mechanisms involved in this effect.

Analysis of the effect of VD3 on the expressionof FcgRII isoforms showed a significant decrea-se in FcgRIIa2 mRNA after 72 h of treatment.The FcgRIIa2 is a soluble form of FcgRIIa lack-ing the transmembrane exon [Rappaport et al.,1993].Transcriptsencoding this formofFcgRIIawere identified in megakariocyte-like humancell lines and platelets [Rappaport et al., 1993],and in Langerhans cells [Astier et al., 1994].Our results show that this form of FcgRIIa isalso produced by the monocytic cell line THP-1,and that its expression is modulated by differ-entiation with VD3. Although soluble FcgRIIa2might be important in vivo in modulatinginteraction of immune complexes with FcgRs,its expression in our experimental system couldnot influence our results as soluble FcgR forms

would be eliminated by washing before thestimulation.

Ourfindingshave established that the effect ofFcgRII crosslinking on Syk tyrosine phosphor-ylation and activation differs between un-differentiated and VD3-differentiated THP-1cells. This effect is not mediated by changes inthe expression of FcgR isoforms. Other studieshave shown a switch in FcgRI signaling path-ways upon monocyte differentiation by IFN-g,mediated by a switch in the accessory moleculerecruited by FcgRI, which lacks its own intrinsicsignalingmotif [Melendez etal., 1998].Together,these findings illustrate that the biochemicalpathways resulting from crosslinking of a parti-cularFcgRdonot depend solely on the particularFcgR isoform that is aggregated, or on the celltype, but that they are also highly dependent onthe differentiation state of the cell, which in vivois subjected to the action of a variety of stimuli.Understanding themechanism bywhich the cellcan modulate the transduction pathways indu-ced by the large family of FcgRs could help to

Fig. 8. (Continued )

1074 Agramonte-Hevia et al.

understand the biological significance of theheterogeneity found in this family of receptorsthat respond to the same ligand, IgG immunecomplexes or IgG opsonized particles.

ACKNOWLEDGMENTS

During the course of these studies, JoseAgramonte, MD, was recipient of a scholar-ship from DGEP-UNAM. We thank Dr. GloriaSoldevila and Dr. Julio Cesar Carrero for cri-tical reading of the manuscript.

REFERENCES

Adams DO, Hamilton TA. 1992. Molecular basis of macro-phage activation: Diversity and its origins. In: Lewis CE,Mc Gee JO’D, editors. The macrophage. New York:Oxford University Press, p 77–103.

Agarwal A, Salem P, Robbins KC. 1993. Involvement of p72Syk, a protein-tyrosine kinase, in Fcg receptor signal-ing. J Biol Chem 268:15900–15905.

Astier A, de la Salle H, de la Salle C, Bieber T, Esposito-Farese ME, Freund M, Cazenave JP, Fridman WH,Teillaud JL, Hanau D. 1994. Human epidermal Langer-hans cells secrete a soluble receptor for IgG (Fc gammaRII/CD32) that inhibits the binding of immune complexesto Fc gamma Rþ cells. J Immunol 152:201–212.

Bolen JB, Brugge JS. 1997. Leukocyte protein tyrosinekinases: Potential targets for drug discovery. Annu RevImmunol 15:371–404.

Bouillon R, Okamura WH, Norman AW. 1995. Structure-function relationships in the vitamin D endocrinesystem. Endocr Rev 16:200–256.

Camacho-Arroyo I, Pasapera AM, Cerbon MA. 1996.Regulation of progesterone receptor gene expression bysex steroid hormones in the hypothalamus and thecerebral cortex of the rabbit. Neurosci Lett 214:25–28.

Cambier JC. 1997. Inhibitory receptors abound? Proc NatlAcad Sci USA 94:5993–5995.

Cassel DL, KellerMA, Surrey S, Schwartz E, Schreiber AD,Rappaport EF, Mc Kenzie SE. 1993. Differential expres-sion of FcgR IIA, FcgR IIB and FcgR IIC in hematopoieticcells: Analysis of transcripts. Mol Immunol 30:451–460.

Chan AC, van Oers NS, Tran A, Turka L, LawCL, Ryan JC,Clark EA, Weiss A. 1994. Differential expression of ZAP-70 and Syk protein tyrosine kinases, and the role of thisfamily of protein tyrosine kinases in TCR signaling. JImmunol 152:4758–4766.

Cheng AM, Rowley B, Pao W, Hayday A., Bolen JB,Pawson T. 1995. Syk tyrosine kinase is required formouse viability and B-cell development. Nature 378:303–306.

Chomczynski P, Sacchi N. 1987. Single-stepmethod of RNAisolation by acid guanidinium thiocyanate-phenol-chloro-form extraction. Anal Biochem 162:156–159.

Choudhuri U, Adams JA, Byrom N, McCarthy DM, BarettJ. 1990. 1,25-Dihydroxyvitamin D3 induces normalmononuclear blood cells to differentiate in the directionof monocyte-macrophage. Haematologia 23:9–19.

D’Ambrosio D, Hippen KL, Minskoff SA, Mellman I, PaniG, Siminovitch KA, Cambier JC. 1995. Recruitment and

activation of PTP1C in negative regulation of antigenreceptor signaling by FcgR IIB1. Science 268:293–297.

D’Ambrosio D, Fong DC, Cambier JC. 1996. The SHIPphosphatase becomes associated with FcgR IIB1 and istyrosine phosphorylated during ‘‘negative’’ signaling.Immunol Lett 54:77–82.

Daeron M. 1997. Fc receptor biology. Annu Rev Immunol15:203–234.

Daeron M, Latour S, Malbec O, Espinosa E, Pina P,Pasmans S, Fridman WH. 1995. The same tyrosine-based inhibition motif, in the intracytoplasmic domain ofFcgR IIB, regulates negatively BCR-, TCR-, and FcR-dependent cell activation. Immunity 3:635–646.

Durden DL, Liu YB. 1994. Protein-tyrosine kinase p72sykin Fc gamma RI receptor signaling. Blood 84:2102–2108.

Dustin LB, Plas DR, Wong J, Hu YT, Soto C, Chan AC,Thomas ML. 1999. Expression of dominant-negative src-homology domain 2-containing protein tyrosine phospha-tase-1 results in increased Syk tyrosine kinase activityand B cell activation. J Immunol 162:2717–2724.

Ernst LK, van de Winkel JGJ, Ing-Ming C, Anderson CL.1992. Three genes for the human high affinity Fc receptorfor IgG (FcgR I) encode four distinct transcriptionproducts. J Biol Chem 267:15692–15700.

Fong DC, Malbec O, Arock M, Cambier JC, Fridman WH,Daeron M. 1996. Selective in vivo recruitment of thephosphatidylinositol phosphatase SHIP by phosphory-lated Fc gammaRIIB during negative regulation of IgE-dependent mouse mast cell activation. Immunol Lett54:83–91.

Gniadecki R. 1998. Involvement of Src in the vitamin Dsignaling in human keratinocytes. Biochem Pharmacol55:499–503.

Greenberg A, Chang P, Silverstein SC. 1994. Tyrosinephosphorylation of the g subunit of Fcg receptors, p72Syk, and paxillin during Fc receptor-mediated phagocy-tosis in macrophages. J Biol Chem 269:3897–3902.

Hunkapillar T, Hood L. 1989. Diversity of the immunoglo-bulin gene superfamily. Adv Immunol 44:1–63.

Indik ZK, Hunter S, HuangMM, Pan XQ, Chien P, Kelly C,Levinson AI, Kimberly RP, Schreiber AD. 1994. The highaffinity Fc gamma receptor (CD 64) induces phagocytosisin the absence of its cytoplasmic domain: The gammasubunit of Fc gamma R IIIA impart phagocytic functionto Fc gamma R I. Exp Hematol 22:599–606.

Indik ZK, Park JG, Hunter S, Mantaring M, Schreiber AD.1995. Molecular dissection of Fc gamma receptor-mediated phagocytosis. Immunol Lett 44:133–138.

Jiao H, Berrada K, Yang W, Tabrizi M, Platanias LC, Yi T.1996 Direct association with and dephosphorylation ofJak2 kinase by the SH2-domain-containing proteintyrosine phosphatase SHP-1. Mol Cell Biol 16:6985–6992.

Jouvin MH, Adamczewsky M, Numberof R, Letourneur O,Valle A, Kinet JP. 1994. Differential control of thetyrosine kinases Lyn and Syk by the two signalingchains of the high affinity immunoglobulin E receptor. JBiol Chem 269:5918–5925.

Kharbanda S, SaleemA, Emoto Y, Stone R, Rapp U, Kufe D.1994. Activation of Raf-1 and mitogen-activated proteinkinases during monocytic differentiation of humanmyeloid leukemia cells. J Biol Chem 269:872–878.

Kiefer F, Brumell J, Al-Alawi N, Latour S, Cheng A,Veillette A, Grinstein S, Pawson T. 1998. The Syk protein

FcgRII Signaling in Monocyte Differentiation 1075

tyrosine kinase is essential for Fcg receptor signaling inmacrophages and neutrophils. Mol Cell Biol 18:4209–4220.

Kiener PA, Rankin BM, Burkharddt AL, Schieven GL,Gilliland LK, Rowley RB, Bolen JB, Ledbetter JA. 1993.Cross-linking of Fcg receptor I (FcgR I) and receptor II(FcgR II) on monocyte cells activates a signal transduc-tion pathway common to both Fc receptors that involvesthe stimulation of p72 Syk protein tyrosine kinase. J BiolChem 268:24442–24448.

Kreutz M, Andreesen R. 1990. Induction of humanmonocyte into macrophage maturation by 1a,25-dihy-droxyvitamin D3. Blood 76:2457–2461.

Leosurne R, Bruhns P, Fridman WH, Daeron M. 2001.Insufficient phosphorylation prevents Fc gamma RIIBfrom recruiting the SH2 domain-containing protein-tyrosine phosphatase SHP-1. J Biol Chem 276:6327–6336.

Mallick-Wood CA, Pao W, Cheng AM, Lewis JM, KulkarniS, Bolen JB, Rowley B, Tigelaar RE, Pawson T, HaydayAC. 1996. Disruption of epithelial gd T cell repertoires bymutation of the Syk tyrosine kinase. Proc Natl Acad SciUSA 93:9704–9709.

Marcinkowaska E, Wiedlocha A, Radzikowsky C. 1997. 1,25-Dihydroxyvitamin D3 induced activation and subse-quent nuclear translocation of MAPK is upstreamregulated by PKC in HL-60 cells. Biochem Biophys ResCommun 241:419–426.

Mates DM, Ernst LK, Chambers WH, Sulica A, HerbermanRB, Morel PA. 1998. Expression of functional CD32molecules on human NK cells is determined by anallelic polymorphism of the FcgR IIC gene. Blood 91:2369–2380.

Matsuda M, Park JG, Wang DC, Hunter S, Chien P,Schreiber AD. 1996. Abrogation of the Fc gammareceptor IIA-mediated phagocytic signal by stem-loopSyk antisense oligonucleotides. Mol Biol Cell 7:1095–1106.

Melendez A, Floto RA, Cameron AJ, Gillooly DJ,Harnett MM, Allen JM. 1998. A molecular switchchanges the signalling pathway used by the Fc gammaRI antibody receptor to mobilize calcium. Curr Biol 8:210–221.

Ono M, Bolland S, Tempst P, Ravetch JV. 1996. Role of theinositol phosphatase SHIP in negative regulation of theimmune system by the receptor FcgR IIB. Nature383:263–266.

Pain S, Falet H, Saci A, Bachelot-Loza C, Rendu F. 2000.Tyrosine phosphorylation and association of Fcgam-maRII and p72 (Syk) are not limited to the FcgammaRIIsignalling pathway. Cell Signal 12:165–171.

Pan XQ, Darby C, Indik ZK, Schreiber AD. 1999. Activationof three classes of nonreceptor tyrosine kinases followingFc gamma receptor crosslinking in human monocytes.Clin Immunol 90:55–64.

Park JG, Murray RK, Chien P, Darby C, Schreiber AD.1993. Conserved cytoplasmic tyrosine residues of thegamma subunit are required for a phagocytic signalmediated by Fc gamma R IIIA. J Clin Invest 92:2073–2079.

Plas DR, Johnson R, Pingel JT, Matthews RJ, Dalton M,Roy G, Chan AC, Thomas ML. 1996. Direct regulation ofZAP-70 by SHP-1 in T cell antigen receptor signaling.Science 272:1173–1176.

Qin S, Yamamura H. 1997. Up-regulation of Syk activityduring HL60 cell differentiation into granulocyte but notinto monocyte/macrophage-linage. Biochem Biophys ResCommun 263:697–701.

Rappaport EF, Cassel DL, Walterhouse DO, McKenzie SE,Surrey S, Keller MA, Schreiber AD, Schwartz E. 1993. Asoluble form of the human Fc receptor Fc gamma R IIA:Cloning, transcript analysis and detection. Exp Hematol21:689–696.

Ravetch JV, Bolland S. 2001. IgG Fc receptors. Annu RevImmunol 19:275–290.

Ravetch JV, Kinet JP. 1991. Fc receptors. Annu RevImmunol 9:457–492.

Reth M. 1989. Antigen receptor tail clue. Nature 338:383–384.

Rowley RB, Burkhardt AL, Chao HG, Matsueda GR, BolenJB. 1995. Syk protein-tyrosine kinase is regulated bytyrosine-phosphorylated Iga/Igb immunoreceptor tyro-sine activation motif binding and autophosphorylation. JBiol Chem 270:11590–11594.

Santana C, Noris G, Espinosa B, Ortega E. 1996. Proteintyrosine phosphorylation in leukocyte activation throughreceptors for IgG. J Leukoc Biol 60:433–440.

Sato K, Ochi A. 1998 Superclustering of B cell receptor andFcgRIIB1 activates Src homology 2-containing proteintyrosine phosphatase-1. J Immunol 161:2716–2722.

Schwende H, Fitzke E, Ambs P, Dieter P. 1996. Differencesin the state of differentiation of THP-1 cells induced byphorbol ester and 1,25-dihydroxyvitamin D3. J LeukocBiol 59:555–561.

Somani AK, Yuen K, Xu F, Zhang J, Branch DR,Siminovitch KA. 2001. The SH2 domain containingtyrosine phosphatase-1 down-regulates activation ofLyn and Lyn-induced tyrosine phosphorylation of theCD19 receptor in B cells. J Biol Chem 276:1938–1944.

Turner M, Mee PJ, Costello PS, Williams O, Price AA,Duddy LP, Furlong MT, Geahlen RL, Tybulewicz VL.1995 Perinatal lethality and blocked B-cell developmentin mice lacking the tyrosine kinase Syk. Nature 378:298–302.

Turner M, Schweighoffer E, Colucci F, Di Santo JP,Tybulewicz VL. 2000. Tyrosine kinase SYK: Essentialfunctions for immunoreceptor signalling. ImmunolToday 21:148–154.

Uesugi Y, Fuse I, Toba K, Kishi K, Furukawa T, Koike T,Aizawa Y. 1999. Involvement of SHP-1, a phosphotyr-osine phosphatase, during myeliod cell differentiation inacute promyelocytic leukemia cell lines. Eur J Haematol62:239–245.

Uesugi Y, Fuse I, Toba K, Kishi K, Hashimoto S, FurukawaT, Narita M, Takahashi M, Aizawa Y. 2000. Inhibition ofATRA-induced myeloid differentiation in acute promye-locytic leukemia by a new protein tyrosine phosphataseinhibitor, 3,4-dephostatin. J Exp Clin Cancer Res19:363–366.

Unkeless JC, Boros P, Fein M. 1992. Structure, signaling,and function of FcgR. In: Gallin JI, Goldestein IM,Snyderman R, editors: Inflammation: Basic principlesand clinical correlates. New York: Raven Press. p 497–510.

Yoshida K, Kharbanda S, Kufe D. 1999. Functionalinteraction between SHPTP1 and the Lyn tyrosinekinase in the apoptotic response to DNA damage. J BiolChem 274:34663–34668.

1076 Agramonte-Hevia et al.